spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Mus musculus
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Monodelphis domestica
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Macaca mulatta
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Pan troglodytes
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Canis familiaris
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Rattus norvegicus
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Gallus gallus
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Homo sapiens
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Ornithorhynchus anatinus
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
Bos taurus
 
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Homo sapiens
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Macaca mulatta
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Canis familiaris
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Monodelphis domestica
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Rattus norvegicus
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Ornithorhynchus anatinus
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Bos taurus
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Pan troglodytes
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Gallus gallus
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
Mus musculus
 
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
Pan troglodytes
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
Bos taurus
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
Monodelphis domestica
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
Homo sapiens
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
Macaca mulatta
mmu-miR-320 miR-320 Mus musculus
AAAAGCUGGGUUGAGAGGGCGA
Mus musculus
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
Gallus gallus
rno-miR-320 miR-320 Rattus norvegicus
AAAAGCUGGGUUGAGAGGGCGA
Rattus norvegicus
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
Canis familiaris
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
Ornithorhynchus anatinus
 
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Pan troglodytes
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Gallus gallus
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Homo sapiens
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Rattus norvegicus
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Macaca mulatta
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Canis familiaris
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Monodelphis domestica
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Mus musculus
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Ornithorhynchus anatinus
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
Bos taurus
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Ornithorhynchus anatinus
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Bos taurus
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Pan troglodytes
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Gallus gallus
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Homo sapiens
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Rattus norvegicus
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Macaca mulatta
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Canis familiaris
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Monodelphis domestica
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
Mus musculus
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Ornithorhynchus anatinus
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Bos taurus
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Pan troglodytes
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Gallus gallus
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Homo sapiens
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Rattus norvegicus
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Macaca mulatta
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Canis familiaris
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Monodelphis domestica
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
Mus musculus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Mus musculus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Ornithorhynchus anatinus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Bos taurus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Pan troglodytes
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Gallus gallus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Homo sapiens
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Rattus norvegicus
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Macaca mulatta
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Canis familiaris
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
Monodelphis domestica
 
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
Danio rerio
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
Takifugu rubripes
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
Gasterosteus aculeatus
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
Oryzias latipes
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
Tetraodon nigroviridis
 
gga-miR-106 miR-106 Gallus gallus
AAAAGUGCUUACAGUGCAGGUA
Gallus gallus
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
Canis familiaris
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
Monodelphis domestica
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
Ornithorhynchus anatinus
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
Bos taurus
hsa-miR-106a miR-106 Homo sapiens
AAAAGUGCUUACAGUGCAGGUAG
Homo sapiens
ptr-miR-106a miR-106 Pan troglodytes
AAAAGUGCUUACAGUGCAGGUAGC
Pan troglodytes
mml-miR-106a miR-106 Macaca mulatta
AAAAGUGCUUACAGUGCAGGUAGC
Macaca mulatta
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Tetraodon nigroviridis
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Oryzias latipes
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Danio rerio
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Takifugu rubripes
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Gasterosteus aculeatus
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
Xenopus tropicalis
 
cbr-miR-357 miR-357 Caenorhabditis briggsae
AAAAUGCCAGUCAUUGACGGA
Caenorhabditis briggsae
 
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Bos taurus
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Canis familiaris
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Ornithorhynchus anatinus
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Pan troglodytes
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Monodelphis domestica
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Macaca mulatta
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Rattus norvegicus
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Homo sapiens
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Mus musculus
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
Gallus gallus

Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

spacer
spacer