spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
dps-bantam bantam Drosophila pseudoobscura
UGAGAUCAUUUUGAAAGCUGAUU
Drosophila pseudoobscura
dme-bantam bantam Drosophila melanogaster
UGAGAUCAUUUUGAAAGCUGAUU
Drosophila melanogaster
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Aedes aegypti
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Anopheles gambiae
 
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Pan troglodytes
gga-let-7c let-7 Gallus gallus
UGAGGUAGUAGGUUGUAUGGUU
Gallus gallus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Bos taurus
tni-let-7g let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUAUAGUU
Tetraodon nigroviridis
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Gasterosteus aculeatus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Canis familiaris
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Macaca mulatta
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Homo sapiens
mmu-let-7g let-7 Mus musculus
UGAGGUAGUAGUUUGUACAGUU
Mus musculus
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
Takifugu rubripes
dme-let-7 let-7 Drosophila melanogaster
UGAGGUAGUAGGUUGUAUAGU
Drosophila melanogaster
rno-let-7a let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUAGUU
Rattus norvegicus
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Ornithorhynchus anatinus
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Oryzias latipes
xtr-let-7a let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUAGUU
Xenopus tropicalis
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Macaca mulatta
mdo-let-7i let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUGCUGU
Monodelphis domestica
dre-let-7d let-7 Danio rerio
UGAGGUAGUUGGUUGUAUGGUU
Danio rerio
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Pan troglodytes
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Bos taurus
gga-let-7f let-7 Gallus gallus
UGAGGUAGUAGAUUGUAUAGUU
Gallus gallus
tni-let-7i let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUGCUGUU
Tetraodon nigroviridis
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Gasterosteus aculeatus
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Aedes aegypti
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
Homo sapiens
rno-let-7c let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUGGUU
Rattus norvegicus
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Ornithorhynchus anatinus
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
Oryzias latipes
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Canis familiaris
xtr-let-7c let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUGGUU
Xenopus tropicalis
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Macaca mulatta
dre-let-7f let-7 Danio rerio
UGAGGUAGUAGAUUGUAUAGUU
Danio rerio
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Pan troglodytes
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
Takifugu rubripes
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Bos taurus
gga-let-7i let-7 Gallus gallus
UGAGGUAGUAGUUUGUGCUGU
Gallus gallus
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
Gasterosteus aculeatus
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Anopheles gambiae
mdo-let-7a let-7 Monodelphis domestica
UGAGGUAGUAGGUUGUAUAGUU
Monodelphis domestica
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
Homo sapiens
mmu-let-7b let-7 Mus musculus
UGAGGUAGUAGGUUGUGUGGUU
Mus musculus
tni-let-7b let-7 Tetraodon nigroviridis
UGAGGUAGUAGGUUGUGUGGUU
Tetraodon nigroviridis
rno-let-7e let-7 Rattus norvegicus
UGAGGUAGGAGGUUGUAUAGUU
Rattus norvegicus
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Ornithorhynchus anatinus
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Canis familiaris
xtr-let-7f let-7 Xenopus tropicalis
UGAGGUAGUAGAUUGUAUAGU
Xenopus tropicalis
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
Macaca mulatta
dre-let-7h let-7 Danio rerio
UGAGGUAGUAAGUUGUGUUGUU
Danio rerio
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
Pan troglodytes
mmu-let-7d let-7 Mus musculus
AGAGGUAGUAGGUUGCAUAGUU
Mus musculus
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
Takifugu rubripes
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
Oryzias latipes
mdo-let-7d let-7 Monodelphis domestica
AGAGGUAGUAGGUUGCAUAGU
Monodelphis domestica
dre-let-7a let-7 Danio rerio
UGAGGUAGUAGGUUGUAUAGUU
Danio rerio
gga-let-7b let-7 Gallus gallus
UGAGGUAGUAGGUUGUGUGGUU
Gallus gallus
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Bos taurus
tni-let-7e let-7 Tetraodon nigroviridis
UGAGGUAGUAGAUUGAAUAGUU
Tetraodon nigroviridis
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
Gasterosteus aculeatus
rno-let-7i let-7 Rattus norvegicus
UGAGGUAGUAGUUUGUGCUGUU
Rattus norvegicus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Ornithorhynchus anatinus
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Canis familiaris
xtr-let-7i let-7 Xenopus tropicalis
UGAGGUAGUAGUUUGUGCUGU
Xenopus tropicalis
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
Macaca mulatta
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Homo sapiens
dre-let-7j let-7 Danio rerio
UGAGGUAGUUGUUUGUACAGUU
Danio rerio
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
Pan troglodytes
mmu-let-7f let-7 Mus musculus
UGAGGUAGUAGAUUGUAUAGUU
Mus musculus
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Takifugu rubripes
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Ornithorhynchus anatinus
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
Oryzias latipes
mdo-let-7g let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUACAGU
Monodelphis domestica
dre-let-7c let-7 Danio rerio
UGAGGUAGUAGGUUGUAUGGUU
Danio rerio
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Bos taurus
gga-let-7d let-7 Gallus gallus
AGAGGUAGUGGGUUGCAUAGU
Gallus gallus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Bos taurus
tni-let-7h let-7 Tetraodon nigroviridis
UGAGGUAGUAAGUUGUGUUGUU
Tetraodon nigroviridis
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
Gasterosteus aculeatus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Canis familiaris
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
Homo sapiens
cbr-let-7 let-7 Caenorhabditis briggsae
UGAGGUAGUAGGUUGUAUAGUU
Caenorhabditis briggsae
mmu-let-7i let-7 Mus musculus
UGAGGUAGUAGUUUGUGCUGUU
Mus musculus
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
Takifugu rubripes
rno-let-7b let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUGUGGUU
Rattus norvegicus
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Ornithorhynchus anatinus
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Oryzias latipes
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Canis familiaris
xtr-let-7b let-7 Xenopus tropicalis
UGAGGUAGUAGUUUGUGUAGUU
Xenopus tropicalis
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Macaca mulatta
dre-let-7e let-7 Danio rerio
UGAGGUAGUAGAUUGAAUAGUU
Danio rerio
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Pan troglodytes
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Bos taurus
gga-let-7g let-7 Gallus gallus
UGAGGUAGUAGUUUGUACAGU
Gallus gallus
tni-let-7j let-7 Tetraodon nigroviridis
UGAGGUAGUUUUUUGUACAGUU
Tetraodon nigroviridis
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Gasterosteus aculeatus
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
Homo sapiens
mmu-let-7a let-7 Mus musculus
UGAGGUAGUAGGUUGUAUAGUU
Mus musculus

Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

spacer
spacer