spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Aedes aegypti
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Anopheles gambiae
 
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Aedes aegypti
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Anopheles gambiae
 
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Aedes aegypti
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Anopheles gambiae
 
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Aedes aegypti
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Anopheles gambiae
 
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Aedes aegypti
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Anopheles gambiae
 
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Aedes aegypti
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Anopheles gambiae
 
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Aedes aegypti
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Anopheles gambiae
 
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Anopheles gambiae
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Aedes aegypti
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Aedes aegypti
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Anopheles gambiae
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Anopheles gambiae
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Aedes aegypti
 
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Aedes aegypti
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Anopheles gambiae
 
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Aedes aegypti
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Anopheles gambiae
 
aga-miR-14 miR-14 Anopheles gambiae
UCAGUCUUUUUCUCUCUCCUA
Aedes aegypti
aga-miR-14 miR-14 Anopheles gambiae
UCAGUCUUUUUCUCUCUCCUA
Anopheles gambiae
 
aga-miR-79 miR-79 Anopheles gambiae
UAAAGCUAGAUUACCAAAGCAU
Aedes aegypti
aga-miR-79 miR-79 Anopheles gambiae
UAAAGCUAGAUUACCAAAGCAU
Anopheles gambiae
 
aga-miR-92a miR-92 Anopheles gambiae
UAUUGCACUUGUCCCGGCCUAU
Aedes aegypti
aga-miR-92a miR-92 Anopheles gambiae
UAUUGCACUUGUCCCGGCCUAU
Anopheles gambiae
aga-miR-92b miR-92 Anopheles gambiae
AAUUGCACUUGUCCCGGCCUGC
Aedes aegypti
aga-miR-92b miR-92 Anopheles gambiae
AAUUGCACUUGUCCCGGCCUGC
Anopheles gambiae
 
aga-miR-100 miR-100 Anopheles gambiae
AACCCGUAGAUCCGAACUUGUG
Aedes aegypti
aga-miR-100 miR-100 Anopheles gambiae
AACCCGUAGAUCCGAACUUGUG
Anopheles gambiae
 
aga-miR-124 miR-124 Anopheles gambiae
UAAGGCACGCGGUGAAUGCCAAG
Anopheles gambiae
aga-miR-124 miR-124 Anopheles gambiae
UAAGGCACGCGGUGAAUGCCAAG
Aedes aegypti
 
aga-miR-125 miR-125 Anopheles gambiae
UCCCUGAGACCCUAACUUGUGA
Aedes aegypti
aga-miR-125 miR-125 Anopheles gambiae
UCCCUGAGACCCUAACUUGUGA
Anopheles gambiae
 
aga-miR-133 miR-133 Anopheles gambiae
UUGGUCCCCUUCAACCAGCUGU
Aedes aegypti
aga-miR-133 miR-133 Anopheles gambiae
UUGGUCCCCUUCAACCAGCUGU
Anopheles gambiae
 
aga-miR-184 miR-184 Anopheles gambiae
UGGACGGAGAACUGAUAAGGG
Aedes aegypti
aga-miR-184 miR-184 Anopheles gambiae
UGGACGGAGAACUGAUAAGGG
Anopheles gambiae
 
aga-miR-210 miR-210 Anopheles gambiae
UUGUGCGUGUGACAACGGCUA
Anopheles gambiae
aga-miR-210 miR-210 Anopheles gambiae
UUGUGCGUGUGACAACGGCUA
Aedes aegypti
 
aga-miR-219 miR-219 Anopheles gambiae
UGAUUGUCCAAACGCAAUUCUUG
Aedes aegypti
aga-miR-219 miR-219 Anopheles gambiae
UGAUUGUCCAAACGCAAUUCUUG
Anopheles gambiae
 
aga-miR-263 miR-263 Anopheles gambiae
UGUAAUGGCACUGGAAGAAUUCAC
Aedes aegypti
aga-miR-263 miR-263 Anopheles gambiae
UGUAAUGGCACUGGAAGAAUUCAC
Anopheles gambiae
 
aga-miR-275 miR-275 Anopheles gambiae
UCAGGUACCUGAAGUAGCGCGCG
Aedes aegypti
aga-miR-275 miR-275 Anopheles gambiae
UCAGGUACCUGAAGUAGCGCGCG
Anopheles gambiae
 
aga-miR-276 miR-276 Anopheles gambiae
CAGCGAGGUAUAGAGUUCCUACG
Aedes aegypti
aga-miR-276 miR-276 Anopheles gambiae
CAGCGAGGUAUAGAGUUCCUACG
Anopheles gambiae
 
aga-miR-277 miR-277 Anopheles gambiae
UAAAUGCACUAUCUGGUACGACA
Aedes aegypti
aga-miR-277 miR-277 Anopheles gambiae
UAAAUGCACUAUCUGGUACGACA
Anopheles gambiae
 
aga-miR-278 miR-278 Anopheles gambiae
UCGGUGGGACUUUCGUCCGUUU
Aedes aegypti
aga-miR-278 miR-278 Anopheles gambiae
UCGGUGGGACUUUCGUCCGUUU
Anopheles gambiae
 
aga-miR-279 miR-279 Anopheles gambiae
UGACUAGAUCCACACUCAUUAA
Aedes aegypti
aga-miR-279 miR-279 Anopheles gambiae
UGACUAGAUCCACACUCAUUAA
Anopheles gambiae
 
aga-miR-281 miR-281 Anopheles gambiae
UGUCAUGGAAUUGCUCUCUUUAU
Aedes aegypti
aga-miR-281 miR-281 Anopheles gambiae
UGUCAUGGAAUUGCUCUCUUUAU
Anopheles gambiae
 
aga-miR-282 miR-282 Anopheles gambiae
AAUCUAGCCUCUUCUAGGCUUUGUCUGU
Aedes aegypti
aga-miR-282 miR-282 Anopheles gambiae
AAUCUAGCCUCUUCUAGGCUUUGUCUGU
Anopheles gambiae
 
aga-miR-283 miR-283 Anopheles gambiae
UAAAUAUCAGCUGGUAAUUCU
Aedes aegypti
aga-miR-283 miR-283 Anopheles gambiae
UAAAUAUCAGCUGGUAAUUCU
Anopheles gambiae
 
aga-miR-305 miR-305 Anopheles gambiae
AUUGUACUUCAUCAGGUGCUCUG
Aedes aegypti
aga-miR-305 miR-305 Anopheles gambiae
AUUGUACUUCAUCAGGUGCUCUG
Anopheles gambiae
 
aga-miR-307 miR-307 Anopheles gambiae
UCACAACCUCCUUGAGUGAG
Aedes aegypti
aga-miR-307 miR-307 Anopheles gambiae
UCACAACCUCCUUGAGUGAG
Anopheles gambiae
 
aga-miR-308 miR-308 Anopheles gambiae
AAUCACAGGAGUAUACUGUGAG
Anopheles gambiae
aga-miR-308 miR-308 Anopheles gambiae
AAUCACAGGAGUAUACUGUGAG
Aedes aegypti
 
aga-miR-315 miR-315 Anopheles gambiae
UUUUGAUUGUUGCUCAGAAAGC
Aedes aegypti
aga-miR-315 miR-315 Anopheles gambiae
UUUUGAUUGUUGCUCAGAAAGC
Anopheles gambiae
 
aga-miR-317 miR-317 Anopheles gambiae
UGAACACAUCUGGUGGUAUCUCAGU
Aedes aegypti
aga-miR-317 miR-317 Anopheles gambiae
UGAACACAUCUGGUGGUAUCUCAGU
Anopheles gambiae
 
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Canis familiaris
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Ornithorhynchus anatinus
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Bos taurus
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Canis familiaris
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Ornithorhynchus anatinus
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Bos taurus
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Canis familiaris
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Ornithorhynchus anatinus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Bos taurus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Canis familiaris
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Ornithorhynchus anatinus
 
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
Bos taurus
 
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Bos taurus
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Canis familiaris
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Ornithorhynchus anatinus
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Bos taurus
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Canis familiaris
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Ornithorhynchus anatinus
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Ornithorhynchus anatinus
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Bos taurus
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
Canis familiaris
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Ornithorhynchus anatinus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Bos taurus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Canis familiaris
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Bos taurus
 
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
Ornithorhynchus anatinus

Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

spacer
spacer