spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 7 of 7
<< prev 1 2 3 4 5 6 7

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
584 picture button
mmu-miR-742 miR-742 Mus musculus
GAAAGCCACCAUGCUGGGUAAA
831 picture button
mmu-miR-743b-5p miR-743 Mus musculus
UGUUCAGACUGGUGUCCAUCA
872 picture button
mmu-miR-743b-3p miR-743 Mus musculus
GAAAGACAUCAUGCUGAAUAGA
842 picture button
mmu-miR-743a miR-743 Mus musculus
GAAAGACACCAAGCUGAGUAGA
864 picture button
hsa-miR-744 miR-744 Homo sapiens
UGCGGGGCUAGGGCUAACAGCA
822 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
855 picture button
hsa-miR-758 miR-758 Homo sapiens
UUUGUGACCUGGUCCACUAACC
896 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
730 picture button
hsa-miR-760 miR-760 Homo sapiens
CGGCUCUGGGUCUGUGGGGA
684 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
777 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
734 picture button
mmu-miR-763 miR-763 Mus musculus
CCAGCUGGGAAGAACCAGUGGC
826 picture button
mmu-miR-764-5p miR-764 Mus musculus
GGUGCUCACAUGUCCUCCU
880 picture button
mmu-miR-764-3p miR-764 Mus musculus
AGGAGGCCAUAGUGGCAACUGU
743 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
538 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
788 picture button
hsa-miR-767-3p miR-767 Homo sapiens
UCUGCUCAUACCCCAUGGUUUCU
866 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
859 picture button
hsa-miR-768-5p miR-768 Homo sapiens
GUUGGAGGAUGAAAGUACGGAGUGAU
762 picture button
hsa-miR-768-3p miR-768 Homo sapiens
UCACAAUGCUGACACUCAAACUGCUGAC
879 picture button
hsa-miR-769-5p miR-769 Homo sapiens
UGAGACCUCUGGGUUCUGAGCU
876 picture button
hsa-miR-769-3p miR-769 Homo sapiens
CUGGGAUCUCCGGGGUCUUGGUU
848 picture button
hsa-miR-770-5p miR-770 Homo sapiens
UCCAGUACCACGUGUCAGGGCCA
886 picture button
hsa-miR-801 miR-801 Homo sapiens
GAUUGCUCUGCGUGCGGAAUCGAC
764 picture button
hsa-miR-802 miR-802 Homo sapiens
CAGUAACAAAGAUUCAUCCUUGU
755 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
722 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
600 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
686 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
758 picture button
hsa-miR-873 miR-873 Homo sapiens
GCAGGAACUUGUGAGUCUCCU
810 picture button
hsa-miR-874 miR-874 Homo sapiens
CUGCCCUGGCCCGAGGGACCGA
727 picture button
hsa-miR-875-5p miR-875 Homo sapiens
UAUACCUCAGUUUUAUCAGGUG
845 picture button
hsa-miR-875-3p miR-875 Homo sapiens
CCUGGAAACACUGAGGUUGUG
815 picture button
hsa-miR-876-5p miR-876 Homo sapiens
UGGAUUUCUUUGUGAAUCACCA
829 picture button
hsa-miR-876-3p miR-876 Homo sapiens
UGGUGGUUUACAAAGUAAUUCA
853 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
520 picture button
mmu-miR-878-5p miR-878 Mus musculus
UAUCUAGUUGGAUGUCAAGACA
805 picture button
mmu-miR-878-3p miR-878 Mus musculus
GCAUGACACCACACUGGGUAGA
874 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
695 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
740 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
767 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
500 picture button
mmu-miR-883a-5p miR-883 Mus musculus
UGCUGAGAGAAGUAGCAGUUAC
1014 picture button
mmu-miR-883b-5p miR-883 Mus musculus
UACUGAGAAUGGGUAGCAGUCA
968 picture button
mmu-miR-883a-3p miR-883 Mus musculus
UAACUGCAACAGCUCUCAGUAU
1006 picture button
mmu-miR-883b-3p miR-883 Mus musculus
UAACUGCAACAUCUCUCAGUAU
1009 picture button
hsa-miR-885-5p miR-885 Homo sapiens
UCCAUUACACUACCCUGCCUCU
892 picture button
hsa-miR-885-3p miR-885 Homo sapiens
AGGCAGCGGGGUGUAGUGGAUA
933 picture button
hsa-miR-886-3p miR-886 Homo sapiens
CGCGGGUGCUUACUGACCCUU
916 picture button
hsa-miR-886-5p miR-886 Homo sapiens
CGGGUCGGAGUUAGCUCAAGCGG
800 picture button
hsa-miR-887 miR-887 Homo sapiens
GUGAACGGGCGCCAUCCCGAGG
803 picture button
hsa-miR-888 miR-888 Homo sapiens
UACUCAAAAAGCUGUCAGUCA
794 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
676 picture button
hsa-miR-890 miR-890 Homo sapiens
UACUUGGAAAGGCAUCAGUUG
776 picture button
hsa-miR-891b miR-891 Homo sapiens
UGCAACUUACCUGAGUCAUUGA
894 picture button
hsa-miR-891a miR-891 Homo sapiens
UGCAACGAACCUGAGCCACUGA
816 picture button
hsa-miR-892a miR-892 Homo sapiens
CACUGUGUCCUUUCUGCGUAG
850 picture button
hsa-miR-892b miR-892 Homo sapiens
CACUGGCUCCUUUCUGGGUAGA
854 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
638 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
715 picture button
hsa-miR-922 miR-922 Homo sapiens
GCAGCAGAGAAUAGGACUACGUC
863 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
729 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
647 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
753 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
699 picture button
hsa-miR-935 miR-935 Homo sapiens
CCAGUUACCGCUUCCGCUACCGC
840 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
711 picture button
hsa-miR-937 miR-937 Homo sapiens
AUCCGCGCUCUGACUCUCUGCC
784 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
766 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
717 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
696 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
695 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
482 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
791 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
556 picture button

Page 7 of 7
<< prev 1 2 3 4 5 6 7

spacer
spacer