spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
865 picture button
hsa-miR-544 miR-544 Homo sapiens
AUUCUGCAUUUUUAGCAAGUUC
724 picture button
bta-miR-545* miR-545* Bos taurus
UCAGUAAAUGUUUAUUGGAUG
538 picture button
bta-miR-545 miR-545 Bos taurus
AUCAACAAACAUUUAUUGUGUG
763 picture button
mmu-miR-546 miR-546 Mus musculus
AUGGUGGCACGGAGUC
797 picture button
mmu-miR-547 miR-547 Mus musculus
CUUGGUACAUCUUUGAGUGAG
822 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
869 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
1065 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
859 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
998 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
776 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
1104 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
872 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
995 picture button
hsa-miR-549 miR-549 Homo sapiens
UGACAACUAUGGAUGAGCUCU
847 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
801 picture button
hsa-miR-551a miR-551 Homo sapiens
GCGACCCACUCUUGGUUUCCA
814 picture button
hsa-miR-551b miR-551 Homo sapiens
GCGACCCAUACUUGGUUUCAG
700 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
739 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
788 picture button
hsa-miR-554 miR-554 Homo sapiens
GCUAGUCCUGACUCAGCCAGU
810 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
682 picture button
hsa-miR-556-5p miR-556 Homo sapiens
GAUGAGCUCAUUGUAAUAUGAG
938 picture button
hsa-miR-556-3p miR-556 Homo sapiens
AUAUUACCAUUAGCUCAUCUUU
880 picture button
hsa-miR-557 miR-557 Homo sapiens
GUUUGCACGGGUGGGCCUUGUCU
853 picture button
hsa-miR-558 miR-558 Homo sapiens
UGAGCUGCUGUACCAAAAU
860 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
476 picture button
hsa-miR-560 miR-560 Homo sapiens
GCGUGCGCCGGCCGGCCGCC
970 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
633 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
819 picture button
hsa-miR-563 miR-563 Homo sapiens
AGGUUGACAUACGUUUCCC
749 picture button
hsa-miR-564 miR-564 Homo sapiens
AGGCACGGUGUCAGCAGGC
778 picture button
hsa-miR-565 miR-565 Homo sapiens
GGCUGGCUCGCGAUGUCUGUUU
730 picture button
hsa-miR-566 miR-566 Homo sapiens
GGGCGCCUGUGAUCCCAAC
751 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
591 picture button
hsa-miR-568 miR-568 Homo sapiens
AUGUAUAAAUGUAUACACAC
660 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
577 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
600 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
783 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
741 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
655 picture button
hsa-miR-574-5p miR-574 Homo sapiens
UGAGUGUGUGUGUGUGAGUGUGU
883 picture button
hsa-miR-574-3p miR-574 Homo sapiens
CACGCUCAUGCACACACCCACA
928 picture button
hsa-miR-575 miR-575 Homo sapiens
GAGCCAGUUGGACAGGAGC
853 picture button
hsa-miR-576-5p miR-576 Homo sapiens
AUUCUAAUUUCUCCACGUCUUU
805 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
774 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
407 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
603 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
734 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
544 picture button
hsa-miR-581 miR-581 Homo sapiens
UCUUGUGUUCUCUAGAUCAGU
749 picture button
hsa-miR-582-3p miR-582 Homo sapiens
UAACUGGUUGAACAACUGAACC
881 picture button
hsa-miR-582-5p miR-582 Homo sapiens
UUACAGUUGUUCAACCAGUUACU
858 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
574 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
684 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
717 picture button
hsa-miR-586 miR-586 Homo sapiens
UAUGCAUUGUAUUUUUAGGUCC
731 picture button
hsa-miR-587 miR-587 Homo sapiens
UUUCCAUAGGUGAUGAGUCAC
806 picture button
hsa-miR-588 miR-588 Homo sapiens
UUGGCCACAAUGGGUUAGAAC
868 picture button
hsa-miR-589 miR-589 Homo sapiens
UGAGAACCACGUCUGCUCUGAG
848 picture button
hsa-miR-590-5p miR-590 Homo sapiens
GAGCUUAUUCAUAAAAGUGCAG
906 picture button
hsa-miR-590-3p miR-590 Homo sapiens
UAAUUUUAUGUAUAAGCUAGU
622 picture button
hsa-miR-591 miR-591 Homo sapiens
AGACCAUGGGUUCUCAUUGU
783 picture button
hsa-miR-592 miR-592 Homo sapiens
UUGUGUCAAUAUGCGAUGAUGU
744 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
622 picture button
hsa-miR-595 miR-595 Homo sapiens
GAAGUGUGCCGUGGUGUGUCU
761 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
889 picture button
hsa-miR-597 miR-597 Homo sapiens
UGUGUCACUCGAUGACCACUGU
778 picture button
hsa-miR-598 miR-598 Homo sapiens
UACGUCAUCGUUGUCAUCGUCA
889 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
646 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
744 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
697 picture button
hsa-miR-602 miR-602 Homo sapiens
GACACGGGCGACAGCUGCGGCCC
752 picture button
hsa-miR-603 miR-603 Homo sapiens
CACACACUGCAAUUACUUUUGC
800 picture button
hsa-miR-604 miR-604 Homo sapiens
AGGCUGCGGAAUUCAGGAC
725 picture button
hsa-miR-605 miR-605 Homo sapiens
UAAAUCCCAUGGUGCCUUCUCCU
938 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
765 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
665 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
696 picture button
hsa-miR-609 miR-609 Homo sapiens
AGGGUGUUUCUCUCAUCUCU
737 picture button
hsa-miR-610 miR-610 Homo sapiens
UGAGCUAAAUGUGUGCUGGGA
766 picture button
hsa-miR-611 miR-611 Homo sapiens
GCGAGGACCCCUCGGGGUCUGAC
749 picture button
hsa-miR-612 miR-612 Homo sapiens
GCUGGGCAGGGCUUCUGAGCUCCUU
788 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
731 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
771 picture button
hsa-miR-615-3p miR-615 Homo sapiens
UCCGAGCCUGGGUCUCCCUCUU
876 picture button
hsa-miR-615-5p miR-615 Homo sapiens
GGGGGUCCCCGGUGCUCGGAUC
851 picture button
hsa-miR-616 miR-616 Homo sapiens
AGUCAUUGGAGGGUUUGAGCAG
688 picture button
hsa-miR-617 miR-617 Homo sapiens
AGACUUCCCAUUUGAAGGUGGC
781 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
759 picture button
hsa-miR-619 miR-619 Homo sapiens
GACCUGGACAUGUUUGUGCCCAGU
730 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
662 picture button
hsa-miR-621 miR-621 Homo sapiens
GGCUAGCAACAGCGCUUACCU
834 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
795 picture button
hsa-miR-623 miR-623 Homo sapiens
AUCCCUUGCAGGGGCUGUUGGGU
673 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
775 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
524 picture button
hsa-miR-626 miR-626 Homo sapiens
AGCUGUCUGAAAAUGUCUU
732 picture button
hsa-miR-627 miR-627 Homo sapiens
GUGAGUCUCUAAGAAAAGAGGA
721 picture button
hsa-miR-628-3p miR-628 Homo sapiens
UCUAGUAAGAGUGGCAGUCGA
841 picture button

Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer