spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-467b miR-467 Mus musculus
GUAAGUGCCUGCAUGUAUAUG
1046 picture button
mmu-miR-467d miR-467 Mus musculus
UAAGUGCGCGCAUGUAUAUGCG
998 picture button
mmu-miR-467a miR-467 Mus musculus
UAAGUGCCUGCAUGUAUAUGCG
1029 picture button
mmu-miR-467c miR-467 Mus musculus
UAAGUGCGUGCAUGUAUAUGUG
1000 picture button
mmu-miR-467e miR-467 Mus musculus
AUAAGUGUGAGCAUGUAUAUGU
848 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
795 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
600 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
634 picture button
mmu-miR-471 miR-471 Mus musculus
UACGUAGUAUAGUGCUUUUCAC
777 picture button
hsa-miR-483-3p miR-483 Homo sapiens
UCACUCCUCUCCUCCCGUCUU
822 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
797 picture button
bta-miR-484 miR-484 Bos taurus
UCAGGCUCAGUCCCCUCCCGAU
746 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
788 picture button
hsa-miR-485-3p miR-485 Homo sapiens
GUCAUACACGGCUCUCCUCUCU
803 picture button
hsa-miR-486-3p miR-486 Homo sapiens
CGGGGCAGCUCAGUACAGGAU
704 picture button
hsa-miR-486-5p miR-486 Homo sapiens
UCCUGUACUGAGCUGCCCCGAG
864 picture button
bta-miR-487b miR-487 Bos taurus
AAUCGUACAGGGUCAUCCACUU
836 picture button
bta-miR-487a miR-487 Bos taurus
AAUCAUACAGGGACAUCCAGU
837 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
640 picture button
hsa-miR-489 miR-489 Homo sapiens
GUGACAUCACAUAUACGGCAGC
907 picture button
hsa-miR-490-5p miR-490 Homo sapiens
CCAUGGAUCUCCAGGUGGGU
721 picture button
hsa-miR-490-3p miR-490 Homo sapiens
CAACCUGGAGGACUCCAUGCUG
827 picture button
hsa-miR-491-3p miR-491 Homo sapiens
CUUAUGCAAGAUUCCCUUCUAC
802 picture button
hsa-miR-491-5p miR-491 Homo sapiens
AGUGGGGAACCCUUCCAUGAGG
736 picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
832 picture button
hsa-miR-493 miR-493 Homo sapiens
UGAAGGUCUACUGUGUGCCAGG
765 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
665 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
797 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
540 picture button
bta-miR-497 miR-497 Bos taurus
CAGCAGCACACUGUGGUUUGUA
877 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
850 picture button
bta-miR-499 miR-499 Bos taurus
UUAAGACUUGCAGUGAUGUUU
777 picture button
hsa-miR-500 miR-500 Homo sapiens
UAAUCCUUGCUACCUGGGUGAGA
796 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
877 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
741 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
885 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
924 picture button
hsa-miR-503 miR-503 Homo sapiens
UAGCAGCGGGAACAGUUCUGCAG
856 picture button
hsa-miR-504 miR-504 Homo sapiens
AGACCCUGGUCUGCACUCUAUC
717 picture button
hsa-miR-505 miR-505 Homo sapiens
CGUCAACACUUGCUGGUUUCCU
845 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
863 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
816 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
637 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
706 picture button
hsa-miR-509-5p miR-509 Homo sapiens
UACUGCAGACAGUGGCAAUCA
816 picture button
hsa-miR-509-3p miR-509 Homo sapiens
UGAUUGGUACGUCUGUGGGUAG
871 picture button
hsa-miR-509-3-5p miR-509 Homo sapiens
UACUGCAGACGUGGCAAUCAUG
876 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
710 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
622 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
911 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
892 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
782 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
853 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
767 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
949 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
906 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
902 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
858 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
781 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
826 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
846 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
758 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
1129 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
1096 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
941 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
1067 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
1090 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
1090 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
963 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1066 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
1022 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1010 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1060 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1006 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1010 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1140 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1125 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1076 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1000 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
979 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1162 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1110 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1119 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
1021 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
1002 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
776 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
699 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
744 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
826 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
908 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
905 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
849 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
707 picture button
bta-miR-532 miR-532 Bos taurus
CAUGCCUUGAGUGUAGGACCGU
861 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
564 picture button
mmu-miR-540-3p miR-540 Mus musculus
AGGUCAGAGGUCGAUCCUGG
940 picture button
mmu-miR-540-5p miR-540 Mus musculus
CAAGGGUCACCCUCUGACUCUGU
839 picture button
hsa-miR-541 miR-541 Homo sapiens
UGGUGGGCACAGAAUCUGGACU
719 picture button
hsa-miR-542-3p miR-542 Homo sapiens
UGUGACAGAUUGAUAACUGAAA
896 picture button
hsa-miR-542-5p miR-542 Homo sapiens
UCGGGGAUCAUCAUGUCACGAGA
728 picture button

Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer