spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
689 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
709 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
779 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
904 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
706 picture button
bta-miR-331 miR-331 Bos taurus
GCCCCUGGGCCUAUCCUAGAA
746 picture button
rno-miR-333 miR-333 Rattus norvegicus
GUGGUGUGCUAGUUACUUUU
709 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
748 picture button
rno-miR-336 miR-336 Rattus norvegicus
UCACCCUUCCAUAUCUAGUCU
783 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
931 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
832 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
1049 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
828 picture button
hsa-miR-339-3p miR-339 Homo sapiens
UGAGCGCCUCGACGACAGAGCCG
902 picture button
hsa-miR-339-5p miR-339 Homo sapiens
UCCCUGUCCUCCAGGAGCUCACG
858 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
539 picture button
mmu-miR-341 miR-341 Mus musculus
UCGGUCGAUCGGUCGGUCGGU
798 picture button
bta-miR-342 miR-342 Bos taurus
UCUCACACAGAAAUCGCACCCAUCU
813 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
664 picture button
mmu-miR-344 miR-344 Mus musculus
UGAUCUAGCCAAAGCCUGACUGU
763 picture button
bta-miR-345 miR-345 Bos taurus
GCUGACUCCUAGUCCAGUGCU
743 picture button
hsa-miR-346 miR-346 Homo sapiens
UGUCUGCCCGCAUGCCUGCCUCU
700 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
714 picture button
rno-miR-349 miR-349 Rattus norvegicus
CAGCCCUGCUGUCUUAACCUCU
734 picture button
mmu-miR-350 miR-350 Mus musculus
UUCACAAAGCCCAUACACUUUC
881 picture button
mmu-miR-351 miR-351 Mus musculus
UCCCUGAGGAGCCCUUUGAGCCUG
851 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
646 picture button
bta-miR-361 miR-361 Bos taurus
UUAUCAGAAUCUCCAGGGGUAC
779 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
791 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
899 picture button
bta-miR-363 miR-363 Bos taurus
AUUGCACGGUAUCCAUCUGCG
794 picture button
bta-miR-365 miR-365 Bos taurus
UAAUGCCCCUAAAAAUCCUUAU
916 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
914 picture button
bta-miR-369-5p miR-369 Bos taurus
AUCGACCGUGUUAUAUUCGC
836 picture button
bta-miR-369-3p miR-369 Bos taurus
AAUAAUACAUGGUUGAUCUUU
771 picture button
hsa-miR-370 miR-370 Homo sapiens
GCCUGCUGGGGUGGAACCUGGU
763 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
929 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
868 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
790 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
853 picture button
bta-miR-374 miR-374 Bos taurus
UUAUAAUACAACCUGAUAAGUG
584 picture button
hsa-miR-375 miR-375 Homo sapiens
UUUGUUCGUUCGGCUCGCGUGA
774 picture button
hsa-miR-376a miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCACGU
793 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
844 picture button
hsa-miR-376b miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCAUGUU
788 picture button
hsa-miR-377 miR-377 Homo sapiens
AUCACACAAAGGCAACUUUUGU
770 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
772 picture button
hsa-miR-379 miR-379 Homo sapiens
UGGUAGACUAUGGAACGUAGG
718 picture button
bta-miR-380-3p miR-380 Bos taurus
UAUGUAAUGUGGUCCACGUCU
697 picture button
bta-miR-380-5p miR-380 Bos taurus
UGGUUGACCAUAGAACAUGCGC
857 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
745 picture button
hsa-miR-382 miR-382 Homo sapiens
GAAGUUGUUCGUGGUGGAUUCG
655 picture button
hsa-miR-383 miR-383 Homo sapiens
AGAUCAGAAGGUGAUUGUGGCU
809 picture button
hsa-miR-384 miR-384 Homo sapiens
AUUCCUAGAAAUUGUUCAUA
728 picture button
hsa-miR-409-5p miR-409 Homo sapiens
AGGUUACCCGAGCAACUUUGCAU
895 picture button
hsa-miR-409-3p miR-409 Homo sapiens
GAAUGUUGCUCGGUGAACCCCU
821 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
661 picture button
hsa-miR-411 miR-411 Homo sapiens
UAGUAGACCGUAUAGCGUACG
742 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
685 picture button
hsa-miR-421 miR-421 Homo sapiens
AUCAACAGACAUUAAUUGGGCGC
881 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
757 picture button
bta-miR-423 miR-423 Bos taurus
AAGCUCGGUCUGAGGCCCCUCAGU
782 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
872 picture button
bta-miR-425-5p miR-425 Bos taurus
AUGACACGAUCACUCCCGUUGA
839 picture button
bta-miR-425-3p miR-425 Bos taurus
AUCGGGAAUGUCGUGUCCGCCC
791 picture button
cfa-miR-429 miR-429 Canis familiaris
UAAUACUGUCUGGUAAUGCCGU
823 picture button
hsa-miR-431 miR-431 Homo sapiens
UGUCUUGCAGGCCGUCAUGCA
758 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
635 picture button
hsa-miR-433 miR-433 Homo sapiens
AUCAUGAUGGGCUCCUCGGUGU
803 picture button
mmu-miR-434-3p miR-434 Mus musculus
UUUGAACCAUCACUCGACUCCU
927 picture button
mmu-miR-434-5p miR-434 Mus musculus
GCUCGACUCAUGGUUUGAACCA
887 picture button
cfa-miR-448 miR-448 Canis familiaris
UUGCAUAUGUAGGAUGUCCCAU
751 picture button
cfa-miR-449 miR-449 Canis familiaris
UGGCAGUGUAUUGUUAGCUGGU
827 picture button
bta-miR-450 miR-450 Bos taurus
UUUUGCGAUGUGUUCCUAAUAU
765 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
845 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
764 picture button
hsa-miR-453 miR-453 Homo sapiens
AGGUUGUCCGUGGUGAGUUCGCA
702 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
908 picture button
bta-miR-455* miR-455* Bos taurus
GCAGUCCAUGGGCAUAUACACU
796 picture button
bta-miR-455 miR-455 Bos taurus
UAUGUGCCUUUGGACUACAUC
856 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
793 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
790 picture button
mmu-miR-463 miR-463 Mus musculus
UGAUAGACACCAUAUAAGGUAG
741 picture button
mmu-miR-464 miR-464 Mus musculus
UACCAAGUUUAUUCUGUGAGAUA
805 picture button
mmu-miR-465a-5p miR-465 Mus musculus
UAUUUAGAAUGGCACUGAUGUGA
708 picture button
mmu-miR-465c-5p miR-465 Mus musculus
UAUUUAGAAUGGCGCUGAUCUG
727 picture button
mmu-miR-465a-3p miR-465 Mus musculus
GAUCAGGGCCUUUCUAAGUAGA
847 picture button
mmu-miR-465b-5p miR-465 Mus musculus
UAUUUAGAAUGGUGCUGAUCUG
736 picture button
mmu-miR-466a-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAAGA
1123 picture button
mmu-miR-466f-3p miR-466 Mus musculus
CAUACACACACACAUACACAC
1334 picture button
mmu-miR-466d-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAG
1144 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
1110 picture button
mmu-miR-466g miR-466 Mus musculus
AUACAGACACAUGCACACACA
1223 picture button
mmu-miR-466e-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUA
1112 picture button
mmu-miR-466c-5p miR-466 Mus musculus
GAUGUGUGUGUGCAUGUACAUA
1132 picture button
mmu-miR-466a-5p miR-466 Mus musculus
UAUGUGUGUGUACAUGUACAUA
1113 picture button
mmu-miR-466f-5p miR-466 Mus musculus
UACGUGUGUGUGCAUGUGCAUG
1173 picture button
mmu-miR-466d-5p miR-466 Mus musculus
UGUGUGUGCGUACAUGUACAUG
1235 picture button
mmu-miR-466b-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUG
1099 picture button
mmu-miR-466h miR-466 Mus musculus
UGUGUGCAUGUGCUUGUGUGUA
1182 picture button

Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer