spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-miR-148a miR-148 Bos taurus
UCAGUGCACUACAGAACUUUGU
903 picture button
bta-miR-148b miR-148 Bos taurus
UCAGUGCAUCACAGAACUUUGU
909 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
681 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
736 picture button
bta-miR-151* miR-151* Bos taurus
UCGAGGAGCUCACAGUCUAGU
488 picture button
bta-miR-151 miR-151 Bos taurus
CUAGACUGAAGCUCCUUGAGG
797 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
933 picture button
hsa-miR-153 miR-153 Homo sapiens
UUGCAUAGUCACAAAAGUGAUC
785 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
735 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
752 picture button
bta-miR-181c miR-181 Bos taurus
AACAUUCAACCUGUCGGUGAGUUU
965 picture button
bta-miR-181b miR-181 Bos taurus
AACAUUCAUUGCUGUCGGUGGGUUU
919 picture button
bta-miR-181a miR-181 Bos taurus
AACAUUCAACGCUGUCGGUGAGUU
981 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
839 picture button
hsa-miR-183 miR-183 Homo sapiens
UAUGGCACUGGUAGAAUUCACU
855 picture button
hsa-miR-184 miR-184 Homo sapiens
UGGACGGAGAACUGAUAAGGGU
763 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
584 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
631 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
713 picture button
hsa-miR-188-5p miR-188 Homo sapiens
CAUCCCUUGCAUGGUGGAGGG
731 picture button
hsa-miR-188-3p miR-188 Homo sapiens
CUCCCACAUGCAGGGUUUGCA
942 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
879 picture button
hsa-miR-190b miR-190 Homo sapiens
UGAUAUGUUUGAUAUUGGGUU
663 picture button
hsa-miR-190 miR-190 Homo sapiens
UGAUAUGUUUGAUAUAUUAGGU
631 picture button
bta-miR-191 miR-191 Bos taurus
CAACGGAAUCCCAAAAGCAGCUG
736 picture button
bta-miR-192 miR-192 Bos taurus
CUGACCUAUGAAUUGACAGCCAG
833 picture button
bta-miR-193a miR-193 Bos taurus
AACUGGCCUACAAAGUCCCAGU
879 picture button
bta-miR-193a* miR-193* Bos taurus
UGGGUCUUUGCGGGCGAGAUGA
584 picture button
hsa-miR-194 miR-194 Homo sapiens
UGUAACAGCAACUCCAUGUGGA
859 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
838 picture button
hsa-miR-196b miR-196 Homo sapiens
UAGGUAGUUUCCUGUUGUUGGG
793 picture button
hsa-miR-196a miR-196 Homo sapiens
UAGGUAGUUUCAUGUUGUUGGG
792 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
839 picture button
hsa-miR-198 miR-198 Homo sapiens
GGUCCAGAGGGGAGAUAGGUUC
854 picture button
bta-miR-199a-3p miR-199 Bos taurus
ACAGUAGUCUGCACAUUGGUUA
917 picture button
bta-miR-199b miR-199 Bos taurus
CCCAGUGUUUAGACUAUCUGUUC
874 picture button
bta-miR-199a-5p miR-199 Bos taurus
CCCAGUGUUCAGACUACCUGUU
901 picture button
bta-miR-200a miR-200 Bos taurus
UAACACUGUCUGGUAACGAUGUU
1027 picture button
bta-miR-200c miR-200 Bos taurus
UAAUACUGCCGGGUAAUGAUGGA
953 picture button
bta-miR-200b miR-200 Bos taurus
UAAUACUGCCUGGUAAUGAUG
1005 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
748 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
697 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
644 picture button
bta-miR-204 miR-204 Bos taurus
UUCCCUUUGUCAUCCUAUGCCU
632 picture button
bta-miR-205 miR-205 Bos taurus
UCCUUCAUUCCACCGGAGUCUG
790 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
715 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
538 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
719 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
726 picture button
bta-miR-210 miR-210 Bos taurus
ACUGUGCGUGUGACAGCGGCUGA
846 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
608 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
952 picture button
bta-miR-214 miR-214 Bos taurus
ACAGCAGGCACAGACAGGCAGU
870 picture button
bta-miR-215 miR-215 Bos taurus
AUGACCUAUGAAUUGACAGACA
829 picture button
hsa-miR-216a miR-216 Homo sapiens
UAAUCUCAGCUGGCAACUGUGA
964 picture button
hsa-miR-216b miR-216 Homo sapiens
AAAUCUCUGCAGGCAAAUGUGA
917 picture button
hsa-miR-217 miR-217 Homo sapiens
UACUGCAUCAGGAACUGAUUGGA
799 picture button
bta-miR-218 miR-218 Bos taurus
UUGUGCUUGAUCUAACCAUGU
815 picture button
hsa-miR-219-2-3p miR-219 Homo sapiens
AGAAUUGUGGCUGGACAUCUGU
786 picture button
hsa-miR-219-1-3p miR-219 Homo sapiens
AGAGUUGAGUCUGGACGUCCCG
905 picture button
hsa-miR-219-5p miR-219 Homo sapiens
UGAUUGUCCAAACGCAAUUCU
923 picture button
hsa-miR-220 miR-220 Homo sapiens
CCACACCGUAUCUGACACUUU
889 picture button
hsa-miR-220c miR-220 Homo sapiens
ACACAGGGCUGUUGUGAAGACU
975 picture button
hsa-miR-220b miR-220 Homo sapiens
CCACCACCGUGUCUGACACUU
1070 picture button
bta-miR-221 miR-221 Bos taurus
AGCUACAUUGUCUGCUGGGUUU
889 picture button
bta-miR-222 miR-222 Bos taurus
AGCUACAUCUGGCUACUGGGU
898 picture button
hsa-miR-223 miR-223 Homo sapiens
UGUCAGUUUGUCAAAUACCCCA
751 picture button
hsa-miR-224 miR-224 Homo sapiens
CAAGUCACUAGUGGUUCCGUU
904 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
929 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
937 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
1013 picture button
mmu-miR-291a-5p miR-291 Mus musculus
CAUCAAAGUGGAGGCCCUCUCU
926 picture button
mmu-miR-291b-5p miR-291 Mus musculus
GAUCAAAGUGGAGGCCCUCUCC
912 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
1059 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
971 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
902 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
738 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
876 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
823 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
808 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
796 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
778 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
709 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
862 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
783 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
783 picture button
hsa-miR-301b miR-301 Homo sapiens
CAGUGCAAUGAUAUUGUCAAAGC
872 picture button
hsa-miR-301a miR-301 Homo sapiens
CAGUGCAAUAGUAUUGUCAAAGC
890 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
917 picture button
hsa-miR-302a miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUGGUGA
937 picture button
hsa-miR-302c miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUCAGUGG
933 picture button
hsa-miR-302b miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUAGUAG
945 picture button
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
808 picture button
mmu-miR-322 miR-322 Mus musculus
CAGCAGCAAUUCAUGUUUUGGA
877 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
865 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
821 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
901 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
919 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
737 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
681 picture button

Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer