spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
407 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
464 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
476 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
482 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
484 picture button
bta-miR-151* miR-151* Bos taurus
UCGAGGAGCUCACAGUCUAGU
488 picture button
bta-miR-142* miR-142* Bos taurus
AGUGUUUCCUACUUUAUGGAUG
489 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
500 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
520 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
524 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
538 picture button
bta-miR-545* miR-545* Bos taurus
UCAGUAAAUGUUUAUUGGAUG
538 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
538 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
539 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
540 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
544 picture button
bta-miR-126* miR-126* Bos taurus
CAUUAUUACUUUUGGUACGCG
547 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
556 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
556 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
560 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
564 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
574 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
577 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
584 picture button
bta-miR-193a* miR-193* Bos taurus
UGGGUCUUUGCGGGCGAGAUGA
584 picture button
bta-miR-374 miR-374 Bos taurus
UUAUAAUACAACCUGAUAAGUG
584 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
584 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
591 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
600 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
600 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
600 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
603 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
608 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
617 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
618 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
618 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
620 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
622 picture button
hsa-miR-590-3p miR-590 Homo sapiens
UAAUUUUAUGUAUAAGCUAGU
622 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
622 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
631 picture button
hsa-miR-190 miR-190 Homo sapiens
UGAUAUGUUUGAUAUAUUAGGU
631 picture button
bta-miR-204 miR-204 Bos taurus
UUCCCUUUGUCAUCCUAUGCCU
632 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
632 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
633 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
634 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
635 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
637 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
638 picture button
mmu-miR-712 miR-712 Mus musculus
CUCCUUCACCCGGGCGGUACC
639 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
640 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
642 picture button
bta-miR-21* miR-21* Bos taurus
AACAGCAGUCGAUGGGCUGUCU
643 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
644 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
646 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
646 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
647 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
651 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
652 picture button
bta-miR-142 miR-142 Bos taurus
CAUAAAGUAGAAAGCACUAC
654 picture button
hsa-miR-382 miR-382 Homo sapiens
GAAGUUGUUCGUGGUGGAUUCG
655 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
655 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
657 picture button
hsa-miR-568 miR-568 Homo sapiens
AUGUAUAAAUGUAUACACAC
660 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
661 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
662 picture button
hsa-miR-190b miR-190 Homo sapiens
UGAUAUGUUUGAUAUUGGGUU
663 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
664 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
665 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
665 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
667 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
672 picture button
hsa-miR-623 miR-623 Homo sapiens
AUCCCUUGCAGGGGCUGUUGGGU
673 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
673 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
675 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
675 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
676 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
679 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
680 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
681 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
681 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
681 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
682 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
684 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
684 picture button
hsa-miR-760 miR-760 Homo sapiens
CGGCUCUGGGUCUGUGGGGA
684 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
685 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
686 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
687 picture button
hsa-miR-616 miR-616 Homo sapiens
AGUCAUUGGAGGGUUUGAGCAG
688 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
689 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
695 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
695 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
696 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
696 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
697 picture button
bta-miR-380-3p miR-380 Bos taurus
UAUGUAAUGUGGUCCACGUCU
697 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
697 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
699 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
699 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer