spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
915 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
788 picture button
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
808 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
776 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
869 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
872 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
859 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
890 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
699 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
797 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
865 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
845 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
838 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
765 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
759 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
684 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1066 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
748 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
819 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
1013 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1010 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1010 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1060 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
971 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
937 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
823 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
790 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
1059 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1076 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
876 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1162 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1125 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1140 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1119 picture button
hsa-miR-216b miR-216 Homo sapiens
AAAUCUCUGCAGGCAAAUGUGA
917 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
556 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
828 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
899 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
779 picture button
bta-miR-21* miR-21* Bos taurus
AACAGCAGUCGAUGGGCUGUCU
643 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
739 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
844 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
840 picture button
bta-miR-181c miR-181 Bos taurus
AACAUUCAACCUGUCGGUGAGUUU
965 picture button
bta-miR-181a miR-181 Bos taurus
AACAUUCAACGCUGUCGGUGAGUU
981 picture button
bta-miR-181b miR-181 Bos taurus
AACAUUCAUUGCUGUCGGUGGGUUU
919 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
852 picture button
hsa-miR-100 miR-100 Homo sapiens
AACCCGUAGAUCCGAACUUGUG
778 picture button
bta-miR-99a miR-99 Bos taurus
AACCCGUAGAUCCGAUCUUGU
811 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
776 picture button
bta-miR-193a miR-193 Bos taurus
AACUGGCCUACAAAGUCCCAGU
879 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
767 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
764 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
797 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
774 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
855 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
798 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
889 picture button
bta-miR-423 miR-423 Bos taurus
AAGCUCGGUCUGAGGCCCCUCAGU
782 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
769 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
632 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
696 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
758 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
868 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1006 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
911 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1110 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
835 picture button
bta-miR-369-3p miR-369 Bos taurus
AAUAAUACAUGGUUGAUCUUU
771 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
1110 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
661 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
556 picture button
bta-miR-487a miR-487 Bos taurus
AAUCAUACAGGGACAUCCAGU
837 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
791 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
741 picture button
bta-miR-487b miR-487 Bos taurus
AAUCGUACAGGGUCAUCCACUU
836 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
877 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
885 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
777 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
914 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
1002 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1000 picture button
hsa-miR-220c miR-220 Homo sapiens
ACACAGGGCUGUUGUGAAGACU
975 picture button
bta-miR-214 miR-214 Bos taurus
ACAGCAGGCACAGACAGGCAGU
870 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
711 picture button
bta-miR-199a-3p miR-199 Bos taurus
ACAGUAGUCUGCACAUUGGUUA
917 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
795 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
734 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
929 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
902 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
929 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
788 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
714 picture button
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
864 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
919 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
757 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
772 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
657 picture button
bta-miR-210 miR-210 Bos taurus
ACUGUGCGUGUGACAGCGGCUGA
846 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
744 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer