spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
969 picture button
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
923 picture button
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
905 picture button
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
920 picture button
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
891 picture button
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
931 picture button
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
925 picture button
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
910 picture button
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
742 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
667 picture button
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
808 picture button
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
851 picture button
hsa-miR-100 miR-100 Homo sapiens
AACCCGUAGAUCCGAACUUGUG
778 picture button
bta-miR-101 miR-101 Bos taurus
UACAGUACUGUGAUAACUGAA
938 picture button
bta-miR-103 miR-103 Bos taurus
AGCAGCAUUGUACAGGGCUAUGA
866 picture button
hsa-miR-105 miR-105 Homo sapiens
UCAAAUGCUCAGACUCCUGUGGU
815 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
890 picture button
bta-miR-107 miR-107 Bos taurus
AGCAGCAUUGUACAGGGCUAUC
869 picture button
bta-miR-122 miR-122 Bos taurus
UGGAGUGUGACAAUGGUGUUUG
782 picture button
bta-miR-124a miR-124 Bos taurus
UUAAGGCACGCGGUGAAUGCCAA
818 picture button
bta-miR-125a miR-125 Bos taurus
UCCCUGAGACCCUUUAACCUGUG
967 picture button
bta-miR-125b miR-125 Bos taurus
UCCCUGAGACCCUAACUUGUGA
984 picture button
bta-miR-126 miR-126 Bos taurus
CGUACCGUGAGUAAUAAUGCG
754 picture button
bta-miR-126* miR-126* Bos taurus
CAUUAUUACUUUUGGUACGCG
547 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
642 picture button
bta-miR-128a miR-128 Bos taurus
UCACAGUGAACCGGUCUCUUUU
938 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
798 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
720 picture button
hsa-miR-130a miR-130 Homo sapiens
CAGUGCAAUGUUAAAAGGGCAU
922 picture button
hsa-miR-130b miR-130 Homo sapiens
CAGUGCAAUGAUGAAAGGGCAU
922 picture button
bta-miR-132 miR-132 Bos taurus
UAACAGUCUACAGCCAUGGUCG
974 picture button
hsa-miR-133a miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUG
834 picture button
hsa-miR-133b miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUA
823 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
778 picture button
hsa-miR-135a miR-135 Homo sapiens
UAUGGCUUUUUAUUCCUAUGUGA
845 picture button
hsa-miR-135b miR-135 Homo sapiens
UAUGGCUUUUCAUUCCUAUGUGA
834 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
714 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
835 picture button
bta-miR-138 miR-138 Bos taurus
AGCUGGUGUUGUGAAUCAGGCCG
837 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
938 picture button
bta-miR-140 miR-140 Bos taurus
UACCACAGGGUAGAACCACGGA
902 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
964 picture button
bta-miR-142 miR-142 Bos taurus
CAUAAAGUAGAAAGCACUAC
654 picture button
bta-miR-142* miR-142* Bos taurus
AGUGUUUCCUACUUUAUGGAUG
489 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
711 picture button
hsa-miR-144 miR-144 Homo sapiens
UACAGUAUAGAUGAUGUACU
875 picture button
bta-miR-145 miR-145 Bos taurus
GUCCAGUUUUCCCAGGAAUCCCU
802 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
820 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
827 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
829 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
777 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
843 picture button
bta-miR-148a miR-148 Bos taurus
UCAGUGCACUACAGAACUUUGU
903 picture button
bta-miR-148b miR-148 Bos taurus
UCAGUGCAUCACAGAACUUUGU
909 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
681 picture button
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
981 picture button
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
944 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
736 picture button
bta-miR-151 miR-151 Bos taurus
CUAGACUGAAGCUCCUUGAGG
797 picture button
bta-miR-151* miR-151* Bos taurus
UCGAGGAGCUCACAGUCUAGU
488 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
933 picture button
hsa-miR-153 miR-153 Homo sapiens
UUGCAUAGUCACAAAAGUGAUC
785 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
735 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
752 picture button
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
902 picture button
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
960 picture button
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
864 picture button
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
886 picture button
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
908 picture button
bta-miR-181c miR-181 Bos taurus
AACAUUCAACCUGUCGGUGAGUUU
965 picture button
bta-miR-181b miR-181 Bos taurus
AACAUUCAUUGCUGUCGGUGGGUUU
919 picture button
bta-miR-181a miR-181 Bos taurus
AACAUUCAACGCUGUCGGUGAGUU
981 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
839 picture button
hsa-miR-183 miR-183 Homo sapiens
UAUGGCACUGGUAGAAUUCACU
855 picture button
hsa-miR-184 miR-184 Homo sapiens
UGGACGGAGAACUGAUAAGGGU
763 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
584 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
631 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
713 picture button
hsa-miR-188-5p miR-188 Homo sapiens
CAUCCCUUGCAUGGUGGAGGG
731 picture button
hsa-miR-188-3p miR-188 Homo sapiens
CUCCCACAUGCAGGGUUUGCA
942 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
879 picture button
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
860 picture button
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
862 picture button
hsa-miR-190b miR-190 Homo sapiens
UGAUAUGUUUGAUAUUGGGUU
663 picture button
hsa-miR-190 miR-190 Homo sapiens
UGAUAUGUUUGAUAUAUUAGGU
631 picture button
bta-miR-191 miR-191 Bos taurus
CAACGGAAUCCCAAAAGCAGCUG
736 picture button
bta-miR-192 miR-192 Bos taurus
CUGACCUAUGAAUUGACAGCCAG
833 picture button
bta-miR-193a miR-193 Bos taurus
AACUGGCCUACAAAGUCCCAGU
879 picture button
bta-miR-193a* miR-193* Bos taurus
UGGGUCUUUGCGGGCGAGAUGA
584 picture button
hsa-miR-194 miR-194 Homo sapiens
UGUAACAGCAACUCCAUGUGGA
859 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
838 picture button
hsa-miR-196b miR-196 Homo sapiens
UAGGUAGUUUCCUGUUGUUGGG
793 picture button
hsa-miR-196a miR-196 Homo sapiens
UAGGUAGUUUCAUGUUGUUGGG
792 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
839 picture button
hsa-miR-198 miR-198 Homo sapiens
GGUCCAGAGGGGAGAUAGGUUC
854 picture button
bta-miR-199a-3p miR-199 Bos taurus
ACAGUAGUCUGCACAUUGGUUA
917 picture button
bta-miR-199b miR-199 Bos taurus
CCCAGUGUUUAGACUAUCUGUUC
874 picture button
bta-miR-199a-5p miR-199 Bos taurus
CCCAGUGUUCAGACUACCUGUU
901 picture button
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
945 picture button
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
943 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer