spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
931 picture button
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
925 picture button
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
742 picture button
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
910 picture button
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
969 picture button
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
923 picture button
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
905 picture button
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
920 picture button
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
891 picture button
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
804 picture button
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
851 picture button
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
808 picture button
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
944 picture button
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
981 picture button
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
902 picture button
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
960 picture button
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
864 picture button
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
908 picture button
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
886 picture button
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
860 picture button
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
862 picture button
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
943 picture button
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
945 picture button
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
786 picture button
bta-miR-21* miR-21* Bos taurus
AACAGCAGUCGAUGGGCUGUCU
643 picture button
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
771 picture button
bta-miR-23b miR-23 Bos taurus
AUCACAUUGCCAGGGAUUACCAC
775 picture button
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
847 picture button
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
810 picture button
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
885 picture button
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
830 picture button
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
842 picture button
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
923 picture button
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
903 picture button
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
958 picture button
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
1045 picture button
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
1016 picture button
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
918 picture button
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
927 picture button
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
946 picture button
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
939 picture button
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
948 picture button
bta-miR-31 miR-31 Bos taurus
AGGCAAGAUGCUGGCAUAGCU
1033 picture button
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
939 picture button
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
906 picture button
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
980 picture button
bta-miR-92 miR-92 Bos taurus
UAUUGCACUUGUCCCGGCCUGU
939 picture button
bta-miR-93 miR-93 Bos taurus
CAAAGUGCUGUUCGUGCAGGUA
930 picture button
bta-miR-98 miR-98 Bos taurus
UGAGGUAGUAAGUUGUAUUGUU
764 picture button
bta-miR-99b miR-99 Bos taurus
CACCCGUAGAACCGACCUUGCG
828 picture button
bta-miR-99a miR-99 Bos taurus
AACCCGUAGAUCCGAUCUUGU
811 picture button
bta-miR-101 miR-101 Bos taurus
UACAGUACUGUGAUAACUGAA
938 picture button
bta-miR-103 miR-103 Bos taurus
AGCAGCAUUGUACAGGGCUAUGA
866 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
890 picture button
bta-miR-107 miR-107 Bos taurus
AGCAGCAUUGUACAGGGCUAUC
869 picture button
bta-miR-122 miR-122 Bos taurus
UGGAGUGUGACAAUGGUGUUUG
782 picture button
bta-miR-124a miR-124 Bos taurus
UUAAGGCACGCGGUGAAUGCCAA
818 picture button
bta-miR-125b miR-125 Bos taurus
UCCCUGAGACCCUAACUUGUGA
984 picture button
bta-miR-125a miR-125 Bos taurus
UCCCUGAGACCCUUUAACCUGUG
967 picture button
bta-miR-126* miR-126* Bos taurus
CAUUAUUACUUUUGGUACGCG
547 picture button
bta-miR-126 miR-126 Bos taurus
CGUACCGUGAGUAAUAAUGCG
754 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
642 picture button
bta-miR-128a miR-128 Bos taurus
UCACAGUGAACCGGUCUCUUUU
938 picture button
bta-miR-132 miR-132 Bos taurus
UAACAGUCUACAGCCAUGGUCG
974 picture button
bta-miR-138 miR-138 Bos taurus
AGCUGGUGUUGUGAAUCAGGCCG
837 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
938 picture button
bta-miR-140 miR-140 Bos taurus
UACCACAGGGUAGAACCACGGA
902 picture button
bta-miR-142* miR-142* Bos taurus
AGUGUUUCCUACUUUAUGGAUG
489 picture button
bta-miR-142 miR-142 Bos taurus
CAUAAAGUAGAAAGCACUAC
654 picture button
bta-miR-145 miR-145 Bos taurus
GUCCAGUUUUCCCAGGAAUCCCU
802 picture button
bta-miR-148b miR-148 Bos taurus
UCAGUGCAUCACAGAACUUUGU
909 picture button
bta-miR-148a miR-148 Bos taurus
UCAGUGCACUACAGAACUUUGU
903 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
736 picture button
bta-miR-151* miR-151* Bos taurus
UCGAGGAGCUCACAGUCUAGU
488 picture button
bta-miR-151 miR-151 Bos taurus
CUAGACUGAAGCUCCUUGAGG
797 picture button
bta-miR-181a miR-181 Bos taurus
AACAUUCAACGCUGUCGGUGAGUU
981 picture button
bta-miR-181c miR-181 Bos taurus
AACAUUCAACCUGUCGGUGAGUUU
965 picture button
bta-miR-181b miR-181 Bos taurus
AACAUUCAUUGCUGUCGGUGGGUUU
919 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
631 picture button
bta-miR-191 miR-191 Bos taurus
CAACGGAAUCCCAAAAGCAGCUG
736 picture button
bta-miR-192 miR-192 Bos taurus
CUGACCUAUGAAUUGACAGCCAG
833 picture button
bta-miR-193a* miR-193* Bos taurus
UGGGUCUUUGCGGGCGAGAUGA
584 picture button
bta-miR-193a miR-193 Bos taurus
AACUGGCCUACAAAGUCCCAGU
879 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
838 picture button
bta-miR-199a-5p miR-199 Bos taurus
CCCAGUGUUCAGACUACCUGUU
901 picture button
bta-miR-199a-3p miR-199 Bos taurus
ACAGUAGUCUGCACAUUGGUUA
917 picture button
bta-miR-199b miR-199 Bos taurus
CCCAGUGUUUAGACUAUCUGUUC
874 picture button
bta-miR-200b miR-200 Bos taurus
UAAUACUGCCUGGUAAUGAUG
1005 picture button
bta-miR-200a miR-200 Bos taurus
UAACACUGUCUGGUAACGAUGUU
1027 picture button
bta-miR-200c miR-200 Bos taurus
UAAUACUGCCGGGUAAUGAUGGA
953 picture button
bta-miR-204 miR-204 Bos taurus
UUCCCUUUGUCAUCCUAUGCCU
632 picture button
bta-miR-205 miR-205 Bos taurus
UCCUUCAUUCCACCGGAGUCUG
790 picture button
bta-miR-210 miR-210 Bos taurus
ACUGUGCGUGUGACAGCGGCUGA
846 picture button
bta-miR-214 miR-214 Bos taurus
ACAGCAGGCACAGACAGGCAGU
870 picture button
bta-miR-215 miR-215 Bos taurus
AUGACCUAUGAAUUGACAGACA
829 picture button
bta-miR-218 miR-218 Bos taurus
UUGUGCUUGAUCUAACCAUGU
815 picture button
bta-miR-221 miR-221 Bos taurus
AGCUACAUUGUCUGCUGGGUUU
889 picture button
bta-miR-222 miR-222 Bos taurus
AGCUACAUCUGGCUACUGGGU
898 picture button
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
808 picture button
bta-miR-331 miR-331 Bos taurus
GCCCCUGGGCCUAUCCUAGAA
746 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer