spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
891 picture button
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
931 picture button
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
925 picture button
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
742 picture button
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
910 picture button
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
969 picture button
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
923 picture button
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
905 picture button
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
920 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
667 picture button
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
804 picture button
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
713 picture button
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
851 picture button
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
808 picture button
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
944 picture button
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
981 picture button
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
902 picture button
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
960 picture button
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
864 picture button
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
908 picture button
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
886 picture button
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
860 picture button
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
862 picture button
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
943 picture button
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
945 picture button
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
786 picture button
bta-miR-21* miR-21* Bos taurus
AACAGCAGUCGAUGGGCUGUCU
643 picture button
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
771 picture button
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
847 picture button
bta-miR-23b miR-23 Bos taurus
AUCACAUUGCCAGGGAUUACCAC
775 picture button
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
810 picture button
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
885 picture button
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
830 picture button
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
842 picture button
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
923 picture button
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
903 picture button
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
821 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
769 picture button
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
958 picture button
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
1045 picture button
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
1016 picture button
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
948 picture button
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
918 picture button
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
927 picture button
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
946 picture button
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
939 picture button
bta-miR-31 miR-31 Bos taurus
AGGCAAGAUGCUGGCAUAGCU
1033 picture button
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
827 picture button
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
924 picture button
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
862 picture button
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
980 picture button
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
939 picture button
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
906 picture button
bta-miR-92 miR-92 Bos taurus
UAUUGCACUUGUCCCGGCCUGU
939 picture button
bta-miR-93 miR-93 Bos taurus
CAAAGUGCUGUUCGUGCAGGUA
930 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
837 picture button
hsa-miR-96 miR-96 Homo sapiens
UUUGGCACUAGCACAUUUUUGCU
917 picture button
bta-miR-98 miR-98 Bos taurus
UGAGGUAGUAAGUUGUAUUGUU
764 picture button
bta-miR-99a miR-99 Bos taurus
AACCCGUAGAUCCGAUCUUGU
811 picture button
bta-miR-99b miR-99 Bos taurus
CACCCGUAGAACCGACCUUGCG
828 picture button
hsa-miR-100 miR-100 Homo sapiens
AACCCGUAGAUCCGAACUUGUG
778 picture button
bta-miR-101 miR-101 Bos taurus
UACAGUACUGUGAUAACUGAA
938 picture button
bta-miR-103 miR-103 Bos taurus
AGCAGCAUUGUACAGGGCUAUGA
866 picture button
hsa-miR-105 miR-105 Homo sapiens
UCAAAUGCUCAGACUCCUGUGGU
815 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
890 picture button
bta-miR-107 miR-107 Bos taurus
AGCAGCAUUGUACAGGGCUAUC
869 picture button
bta-miR-122 miR-122 Bos taurus
UGGAGUGUGACAAUGGUGUUUG
782 picture button
bta-miR-124a miR-124 Bos taurus
UUAAGGCACGCGGUGAAUGCCAA
818 picture button
bta-miR-125b miR-125 Bos taurus
UCCCUGAGACCCUAACUUGUGA
984 picture button
bta-miR-125a miR-125 Bos taurus
UCCCUGAGACCCUUUAACCUGUG
967 picture button
bta-miR-126 miR-126 Bos taurus
CGUACCGUGAGUAAUAAUGCG
754 picture button
bta-miR-126* miR-126* Bos taurus
CAUUAUUACUUUUGGUACGCG
547 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
642 picture button
bta-miR-128a miR-128 Bos taurus
UCACAGUGAACCGGUCUCUUUU
938 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
720 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
798 picture button
hsa-miR-130b miR-130 Homo sapiens
CAGUGCAAUGAUGAAAGGGCAU
922 picture button
hsa-miR-130a miR-130 Homo sapiens
CAGUGCAAUGUUAAAAGGGCAU
922 picture button
bta-miR-132 miR-132 Bos taurus
UAACAGUCUACAGCCAUGGUCG
974 picture button
hsa-miR-133b miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUA
823 picture button
hsa-miR-133a miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUG
834 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
778 picture button
hsa-miR-135b miR-135 Homo sapiens
UAUGGCUUUUCAUUCCUAUGUGA
834 picture button
hsa-miR-135a miR-135 Homo sapiens
UAUGGCUUUUUAUUCCUAUGUGA
845 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
714 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
835 picture button
bta-miR-138 miR-138 Bos taurus
AGCUGGUGUUGUGAAUCAGGCCG
837 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
938 picture button
bta-miR-140 miR-140 Bos taurus
UACCACAGGGUAGAACCACGGA
902 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
964 picture button
bta-miR-142* miR-142* Bos taurus
AGUGUUUCCUACUUUAUGGAUG
489 picture button
bta-miR-142 miR-142 Bos taurus
CAUAAAGUAGAAAGCACUAC
654 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
711 picture button
hsa-miR-144 miR-144 Homo sapiens
UACAGUAUAGAUGAUGUACU
875 picture button
bta-miR-145 miR-145 Bos taurus
GUCCAGUUUUCCCAGGAAUCCCU
802 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
829 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
820 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
827 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
843 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
777 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer