spacer

MicroRNA Listing for Gasterosteus aculeatus


172 microRNAs (0 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
461 picture button
dre-miR-724 miR-724 Danio rerio
UUAAAGGGAAUUUGCGACUGUU
513 picture button
fru-miR-142a miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACU
576 picture button
fru-miR-129 miR-129 Takifugu rubripes
CUUUUUGCGGUCUGGGCUUGCU
577 picture button
fru-miR-142b miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACUA
589 picture button
fru-miR-190 miR-190 Takifugu rubripes
UGAUAUGUUUGAUAUAUUAGGU
589 picture button
dre-miR-461 miR-461 Danio rerio
UCAGGAAUGGGCUAAAUGCCAA
615 picture button
fru-miR-458 miR-458 Takifugu rubripes
AUAGCUCUUUAAAUGGUACUGC
619 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
630 picture button
fru-miR-203 miR-203 Takifugu rubripes
GUGAAAUGUUUAGGACCACUUG
645 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
646 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
648 picture button
dre-miR-722 miR-722 Danio rerio
UUUUUUGCAGAAACGUUUCAGAUU
652 picture button
fru-miR-375 miR-375 Takifugu rubripes
UUUGUUCGUUCGGCUCGCGUUA
653 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
657 picture button
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
665 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
666 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
666 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
678 picture button
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
679 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
679 picture button
dre-miR-733 miR-733 Danio rerio
UGCGUUGGUUUAGCUCAGUGGUU
679 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
691 picture button
fru-miR-214 miR-214 Takifugu rubripes
ACAGCAGGCACAGACAGGCAG
696 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
698 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
702 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
709 picture button
fru-miR-122 miR-122 Takifugu rubripes
UGGAGUGUGACAAUGGUGUUUG
717 picture button
xtr-miR-428 miR-428 Xenopus tropicalis
UAAGUGCUCUCUAGUUCGGUUG
718 picture button
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
724 picture button
dre-miR-206 miR-206 Danio rerio
UGGAAUGUAAGGAAGUGUGUGG
726 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
727 picture button
fru-miR-196a miR-196 Takifugu rubripes
UAGGUAGUUUCAUGUUGUUGGG
732 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
733 picture button
dre-miR-730 miR-730 Danio rerio
UCCUCAUUGUGCAUGCUGUGUGU
743 picture button
fru-miR-202 miR-202 Takifugu rubripes
AGAGGCAUAGGGCAUGGGAAAA
746 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
747 picture button
fru-miR-100 miR-100 Takifugu rubripes
AACCCGUAGAUCCGAACUUGUG
748 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
749 picture button
fru-miR-223 miR-223 Takifugu rubripes
UGUCAGUUUGUCAAAUACCCC
750 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
750 picture button
fru-miR-204 miR-204 Takifugu rubripes
UUCCCUUUGUCAUCCUAUGCCU
751 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
753 picture button
fru-miR-489 miR-489 Takifugu rubripes
AGUGACAUCAUAUGUACGGCUGC
754 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
755 picture button
fru-miR-184 miR-184 Takifugu rubripes
UGGACGGAGAACUGAUAAGGG
759 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
762 picture button
fru-miR-153b miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAAUGAGC
763 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
765 picture button
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
772 picture button
fru-miR-140 miR-140 Takifugu rubripes
CAGUGGUUUUACCCUAUGGUAG
772 picture button
fru-miR-153a miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAGUGAUC
776 picture button
fru-miR-187 miR-187 Takifugu rubripes
UCGUGUCUUGUGUUGCAGCC
781 picture button
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
783 picture button
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
786 picture button
fru-miR-196b miR-196 Takifugu rubripes
UAGGUAGUUUCAAGUUGUUGGG
788 picture button
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
789 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
791 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
793 picture button
dre-miR-459 miR-459 Danio rerio
UCAGUAACAAGGAUUCAUCCUG
796 picture button
fru-miR-205 miR-205 Takifugu rubripes
UCCUUCAUUCCACCGGAGUCUG
801 picture button
fru-miR-217 miR-217 Takifugu rubripes
UACUGCAUCAGGAACUGAUUGG
801 picture button
fru-miR-194 miR-194 Takifugu rubripes
UGUAACAGCAACUCCAUGUGG
802 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
803 picture button
fru-miR-135a miR-135 Takifugu rubripes
UAUGGCUUUCUAUUCCUAUGUG
805 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
809 picture button
fru-miR-138 miR-138 Takifugu rubripes
AGCUGGUGUUGUGAAUCAGGCC
810 picture button
fru-miR-218b miR-218 Takifugu rubripes
UUGUGCUUGAUCUAACCAUGCA
810 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
811 picture button
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
812 picture button
dre-miR-726 miR-726 Danio rerio
UUCACUACUAGCAGAACUCGG
812 picture button
xtr-miR-302 miR-302 Xenopus tropicalis
UAAGUGCUCCAAUGUUUUAGUGG
813 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
816 picture button
fru-miR-218a miR-218 Takifugu rubripes
UUGUGCUUGAUCUAACCAUGUG
817 picture button
fru-miR-103 miR-103 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUGA
819 picture button
fru-miR-182 miR-182 Takifugu rubripes
UGGUUCUAGACUUGCCAACUA
825 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
825 picture button
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
826 picture button
fru-miR-148 miR-148 Takifugu rubripes
UCAGUGCAUUACAGAACUUUGU
826 picture button
fru-miR-199 miR-199 Takifugu rubripes
CCCAGUGUUCAGACUACCUGUUC
828 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
828 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
830 picture button
dre-miR-499 miR-499 Danio rerio
UUAAGACUUGCAGUGAUGUUUA
831 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
835 picture button
fru-miR-192 miR-192 Takifugu rubripes
AUGACCUAUGAAUUGACAGCC
836 picture button
fru-miR-107 miR-107 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUCA
838 picture button
fru-miR-152 miR-152 Takifugu rubripes
UCAGUGCAUAACAGAACUUUGU
838 picture button
fru-miR-210 miR-210 Takifugu rubripes
CUGUGCGUGUGACAGCGGCUAA
838 picture button
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
840 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
841 picture button
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
843 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
845 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
849 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
852 picture button
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
854 picture button
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
855 picture button
fru-miR-126 miR-126 Takifugu rubripes
UCGUACCGUGAGUAAUAAUGC
855 picture button
fru-miR-135b miR-135 Takifugu rubripes
UAUGGCUUUUUAUUCCUAUCUG
855 picture button
fru-miR-193 miR-193 Takifugu rubripes
AACUGGCCUACAAAGUCCCAGU
858 picture button
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
860 picture button

Page 1 of 2
1 2 next >>

spacer
spacer