spacer

MicroRNA Listing for Gasterosteus aculeatus


172 microRNAs (0 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
765 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
925 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
816 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
811 picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
895 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
749 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
835 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
974 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
648 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
928 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
860 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
897 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
900 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
830 picture button
dre-miR-206 miR-206 Danio rerio
UGGAAUGUAAGGAAGUGUGUGG
726 picture button
dre-miR-220 miR-220 Danio rerio
CCACAACCGUAUCGGACACUU
965 picture button
dre-miR-363 miR-363 Danio rerio
AAUUGCACGGUAUCCAUCUGUA
891 picture button
dre-miR-430b miR-430 Danio rerio
AAAGUGCUAUCAAGUUGGGGUAG
860 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
852 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
841 picture button
dre-miR-430c miR-430 Danio rerio
UAAGUGCUUCUCUUUGGGGUAG
995 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
883 picture button
dre-miR-451 miR-451 Danio rerio
AAACCGUUACCAUUACUGAGUU
920 picture button
dre-miR-454b miR-454 Danio rerio
UAGUGCAAUAUUGCUUAUAGGG
867 picture button
dre-miR-454a miR-454 Danio rerio
UAGUGCAAUAUUGCUAAUAGGG
874 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
747 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
678 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
733 picture button
dre-miR-459 miR-459 Danio rerio
UCAGUAACAAGGAUUCAUCCUG
796 picture button
dre-miR-461 miR-461 Danio rerio
UCAGGAAUGGGCUAAAUGCCAA
615 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
666 picture button
dre-miR-499 miR-499 Danio rerio
UUAAGACUUGCAGUGAUGUUUA
831 picture button
dre-miR-722 miR-722 Danio rerio
UUUUUUGCAGAAACGUUUCAGAUU
652 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
709 picture button
dre-miR-724 miR-724 Danio rerio
UUAAAGGGAAUUUGCGACUGUU
513 picture button
dre-miR-725 miR-725 Danio rerio
UUCAGUCAUUGUUUCUAGUAGU
889 picture button
dre-miR-726 miR-726 Danio rerio
UUCACUACUAGCAGAACUCGG
812 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
657 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
646 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
679 picture button
dre-miR-730 miR-730 Danio rerio
UCCUCAUUGUGCAUGCUGUGUGU
743 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
762 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
791 picture button
dre-miR-733 miR-733 Danio rerio
UGCGUUGGUUUAGCUCAGUGGUU
679 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
698 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
825 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
630 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
666 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
727 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
755 picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
461 picture button
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
894 picture button
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
888 picture button
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
875 picture button
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
923 picture button
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
890 picture button
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
887 picture button
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
860 picture button
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
871 picture button
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
665 picture button
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
679 picture button
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
724 picture button
fru-miR-10b miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUUUGUG
913 picture button
fru-miR-10d miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUGUGUGUG
974 picture button
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
915 picture button
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
870 picture button
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
877 picture button
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
783 picture button
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
954 picture button
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
789 picture button
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
812 picture button
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
826 picture button
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
905 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
845 picture button
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
843 picture button
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
861 picture button
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
772 picture button
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
786 picture button
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
884 picture button
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
879 picture button
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
855 picture button
fru-miR-27e miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCAGUG
952 picture button
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
955 picture button
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
978 picture button
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
1000 picture button
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
984 picture button
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
854 picture button
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
871 picture button
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
840 picture button
fru-miR-92 miR-92 Takifugu rubripes
UAUUGCACUUGUCCCGGCCUGU
939 picture button
fru-miR-96 miR-96 Takifugu rubripes
UUUGGCACUAGCACAUUUUUGCU
875 picture button
fru-miR-100 miR-100 Takifugu rubripes
AACCCGUAGAUCCGAACUUGUG
748 picture button
fru-miR-101b miR-101 Takifugu rubripes
UACAGUACUAUGAUAACUGAAG
947 picture button
fru-miR-101a miR-101 Takifugu rubripes
UACAGUACUGUGAUAACUGAAG
953 picture button
fru-miR-103 miR-103 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUGA
819 picture button
fru-miR-107 miR-107 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUCA
838 picture button
fru-miR-122 miR-122 Takifugu rubripes
UGGAGUGUGACAAUGGUGUUUG
717 picture button
fru-miR-124 miR-124 Takifugu rubripes
UAAGGCACGCGGUGAAUGCCAA
917 picture button
fru-miR-125a miR-125 Takifugu rubripes
UCCCUGAGACCCUUAACCUGUG
976 picture button
fru-miR-125b miR-125 Takifugu rubripes
UCCCUGAGACCCUAACUUGUGA
961 picture button

Page 1 of 2
1 2 next >>

spacer
spacer