spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 3 of 3
<< prev 1 2 3

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
740 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
724 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
725 picture button
dre-miR-458 miR-458 Danio rerio
AUAGCUCUUUGAAUGGUACUGC
658 picture button
dre-miR-459* miR-459* Danio rerio
CAGGGAAUCUCUGUUACUGGGG
540 picture button
dre-miR-459 miR-459 Danio rerio
UCAGUAACAAGGAUUCAUCCUG
812 picture button
dre-miR-460-5p miR-460 Danio rerio
CCUGCAUUGUACACACUGUGCG
772 picture button
dre-miR-460-3p miR-460 Danio rerio
CACAGCGCAUACAAUGUGGAUG
977 picture button
dre-miR-461 miR-461 Danio rerio
UCAGGAAUGGGCUAAAUGCCAA
543 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
586 picture button
dre-miR-489 miR-489 Danio rerio
AGUGACAUCAUAUGUACGGCUGC
815 picture button
dre-miR-499 miR-499 Danio rerio
UUAAGACUUGCAGUGAUGUUUA
704 picture button
dre-miR-722 miR-722 Danio rerio
UUUUUUGCAGAAACGUUUCAGAUU
653 picture button
dre-miR-723* miR-723* Danio rerio
GACAGUUUUAAAUGAUGUUACUUU
610 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
788 picture button
dre-miR-724 miR-724 Danio rerio
UUAAAGGGAAUUUGCGACUGUU
638 picture button
dre-miR-725 miR-725 Danio rerio
UUCAGUCAUUGUUUCUAGUAGU
848 picture button
dre-miR-726 miR-726 Danio rerio
UUCACUACUAGCAGAACUCGG
825 picture button
dre-miR-727* miR-727* Danio rerio
UCAGUCUUCAAUUCCUCCCAGC
721 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
690 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
644 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
666 picture button
dre-miR-730 miR-730 Danio rerio
UCCUCAUUGUGCAUGCUGUGUGU
758 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
749 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
773 picture button
dre-miR-733 miR-733 Danio rerio
UGCGUUGGUUUAGCUCAGUGGUU
671 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
702 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
860 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
609 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
680 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
771 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
793 picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
477 picture button

Page 3 of 3
<< prev 1 2 3

spacer
spacer