spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 2 of 3
<< prev 1 2 3 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-133b miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUA
827 picture button
dre-miR-133a* miR-133* Danio rerio
AGCUGGUAAAAUGGAACCAAAU
699 picture button
dre-miR-133a miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUG
846 picture button
dre-miR-133c miR-133 Danio rerio
UUUGGUCCCUUUCAACCAGCUA
860 picture button
dre-miR-135c miR-135 Danio rerio
UAUGGCUUUCUAUUCCUAUGUG
805 picture button
dre-miR-135b miR-135 Danio rerio
UAUGGCUUUUUAUUCCUAUCUG
768 picture button
dre-miR-135a miR-135 Danio rerio
UAUGGCUUUUUAUUCCUAUGUGA
825 picture button
dre-miR-137 miR-137 Danio rerio
UUAUUGCUUAAGAAUACGCGUA
883 picture button
dre-miR-138 miR-138 Danio rerio
AGCUGGUGUUGUGAAUCAGGCC
886 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
787 picture button
dre-miR-140* miR-140* Danio rerio
UACCACAGGGUAGAACCACGGAC
799 picture button
dre-miR-140 miR-140 Danio rerio
CAGUGGUUUUACCCUAUGGUAG
725 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
922 picture button
dre-miR-142a-5p miR-142 Danio rerio
CAUAAAGUAGAAAGCACUACU
627 picture button
dre-miR-142a-3p miR-142 Danio rerio
UGUAGUGUUUCCUACUUUAUGGA
760 picture button
dre-miR-142b-5p miR-142 Danio rerio
CAUAAAGUAGACAGCACUACUA
614 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
689 picture button
dre-miR-144 miR-144 Danio rerio
UACAGUAUAGAUGAUGUACU
738 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
774 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
871 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
855 picture button
dre-miR-148 miR-148 Danio rerio
UCAGUGCAUUACAGAACUUUGU
886 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
776 picture button
dre-miR-152 miR-152 Danio rerio
UCAGUGCAUGACAGAACUUUGG
912 picture button
dre-miR-153c miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAUC
741 picture button
dre-miR-153b miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAGC
776 picture button
dre-miR-153a miR-153 Danio rerio
UUGCAUAGUCACAAAAGUGAUC
781 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
800 picture button
dre-miR-181c miR-181 Danio rerio
CACAUUCAUUGCUGUCGGUGGG
876 picture button
dre-miR-181b miR-181 Danio rerio
AACAUUCAUUGCUGUCGGUGGG
853 picture button
dre-miR-181a* miR-181* Danio rerio
ACCAUCGACCGUUGAUUGUACC
729 picture button
dre-miR-181a miR-181 Danio rerio
AACAUUCAACGCUGUCGGUGAGU
826 picture button
dre-miR-182* miR-182* Danio rerio
UGGUUCUAGACUUGCCAACUA
647 picture button
dre-miR-182 miR-182 Danio rerio
UUUGGCAAUGGUAGAACUCACA
840 picture button
dre-miR-183 miR-183 Danio rerio
UAUGGCACUGGUAGAAUUCACUG
857 picture button
dre-miR-184 miR-184 Danio rerio
UGGACGGAGAACUGAUAAGGGC
841 picture button
dre-miR-187 miR-187 Danio rerio
UCGUGUCUUGUGUUGCAGCC
648 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
787 picture button
dre-miR-190b miR-190 Danio rerio
UGAUAUGUUUGAUAUUCGGUUG
746 picture button
dre-miR-190 miR-190 Danio rerio
UGAUAUGUUUGAUAUAUUAGGU
723 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
743 picture button
dre-miR-192 miR-192 Danio rerio
AUGACCUAUGAAUUGACAGCC
790 picture button
dre-miR-193b miR-193 Danio rerio
AACUGGCCCGCAAAGUCCCGCU
1027 picture button
dre-miR-193a miR-193 Danio rerio
AACUGGCCUACAAAGUCCCAGU
997 picture button
dre-miR-194b miR-194 Danio rerio
UGUAACAGCCGCUCCAUGUGGA
796 picture button
dre-miR-194a miR-194 Danio rerio
UGUAACAGCAACUCCAUGUGG
786 picture button
dre-miR-196b miR-196 Danio rerio
UAGGUAGUUUCAAGUUGUUGGG
779 picture button
dre-miR-196a miR-196 Danio rerio
UAGGUAGUUUCAUGUUGUUGGG
807 picture button
dre-miR-199 miR-199 Danio rerio
CCCAGUGUUCAGACUACCUGUUC
866 picture button
dre-miR-199* miR-199* Danio rerio
UACAGUAGUCUGCACAUUGGUU
648 picture button
dre-miR-200a miR-200 Danio rerio
UAACACUGUCUGGUAACGAUGU
1059 picture button
dre-miR-200c miR-200 Danio rerio
UAAUACUGCCUGGUAAUGAUGC
957 picture button
dre-miR-200b miR-200 Danio rerio
UAAUACUGCCUGGUAAUGAUGA
952 picture button
dre-miR-202 miR-202 Danio rerio
AGAGGCAUAGGGCAUGGGAAAA
748 picture button
dre-miR-202* miR-202* Danio rerio
UUCCUAUGCAUAUACCUCUUUG
699 picture button
dre-miR-203b miR-203 Danio rerio
GUGAAAUGUUCAGGACCACUUG
648 picture button
dre-miR-203a miR-203 Danio rerio
GUGAAAUGUUUAGGACCACUUG
611 picture button
dre-miR-203b* miR-203* Danio rerio
AGUGGUUCUCAACAGUUCAACA
606 picture button
dre-miR-204 miR-204 Danio rerio
UUCCCUUUGUCAUCCUAUGCCU
811 picture button
dre-miR-205 miR-205 Danio rerio
UCCUUCAUUCCACCGGAGUCUG
792 picture button
dre-miR-206 miR-206 Danio rerio
UGGAAUGUAAGGAAGUGUGUGG
710 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
663 picture button
dre-miR-210* miR-210* Danio rerio
AGCCACUGACUAACGCACAUUG
706 picture button
dre-miR-210 miR-210 Danio rerio
CUGUGCGUGUGACAGCGGCUAA
757 picture button
dre-miR-212 miR-212 Danio rerio
UAACAGUCUACAGUCAUGGCU
860 picture button
dre-miR-214 miR-214 Danio rerio
ACAGCAGGCACAGACAGGCAG
835 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
767 picture button
dre-miR-216b miR-216 Danio rerio
UAAUCUCUGCAGGCAACUGUGA
977 picture button
dre-miR-216a miR-216 Danio rerio
UAAUCUCAGCUGGCAACUGUGA
1012 picture button
dre-miR-217 miR-217 Danio rerio
UACUGCAUCAGGAACUGAUUGG
877 picture button
dre-miR-218b miR-218 Danio rerio
UUGUGCUUGAUCUAACCAUGCA
804 picture button
dre-miR-218a miR-218 Danio rerio
UUGUGCUUGAUCUAACCAUGUG
805 picture button
dre-miR-219 miR-219 Danio rerio
UGAUUGUCCAAACGCAAUUCUU
920 picture button
dre-miR-220 miR-220 Danio rerio
CCACAACCGUAUCGGACACUU
924 picture button
dre-miR-221 miR-221 Danio rerio
AGCUACAUUGUCUGCUGGGUUUC
867 picture button
dre-miR-222 miR-222 Danio rerio
AGCUACAUCUGGCUACUGGGUCUC
850 picture button
dre-miR-223 miR-223 Danio rerio
UGUCAGUUUGUCAAAUACCCC
703 picture button
dre-miR-301b miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAUUG
788 picture button
dre-miR-301a miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAAAG
870 picture button
dre-miR-301c miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAUAG
806 picture button
xtr-miR-302 miR-302 Xenopus tropicalis
UAAGUGCUCCAAUGUUUUAGUGG
792 picture button
dre-miR-338 miR-338 Danio rerio
UCCAGCAUCAGUGAUUUUGUUG
795 picture button
dre-miR-363 miR-363 Danio rerio
AAUUGCACGGUAUCCAUCUGUA
855 picture button
dre-miR-365 miR-365 Danio rerio
UAAUGCCCCUAAAAAUCCUUAU
853 picture button
xtr-miR-367 miR-367 Xenopus tropicalis
AAUUGCACUGUAGCAAUGGUGA
839 picture button
dre-miR-375 miR-375 Danio rerio
UUUGUUCGUUCGGCUCGCGUUA
737 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
739 picture button
xtr-miR-425-5p miR-425 Xenopus tropicalis
AAUGACACGAUCACUCCCGUUGA
943 picture button
xtr-miR-428 miR-428 Xenopus tropicalis
UAAGUGCUCUCUAGUUCGGUUG
695 picture button
dre-miR-429 miR-429 Danio rerio
UAAUACUGUCUGGUAAUGCCGU
838 picture button
dre-miR-430b miR-430 Danio rerio
AAAGUGCUAUCAAGUUGGGGUAG
803 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
768 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
775 picture button
dre-miR-430c miR-430 Danio rerio
UAAGUGCUUCUCUUUGGGGUAG
926 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
756 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
751 picture button
dre-miR-451 miR-451 Danio rerio
AAACCGUUACCAUUACUGAGUU
831 picture button
dre-miR-454b miR-454 Danio rerio
UAGUGCAAUAUUGCUUAUAGGG
836 picture button
dre-miR-454a miR-454 Danio rerio
UAGUGCAAUAUUGCUAAUAGGG
828 picture button
dre-miR-455 miR-455 Danio rerio
UAUGUGCCCUUGGACUACAUCG
880 picture button

Page 2 of 3
<< prev 1 2 3 next >>

spacer
spacer