spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 1 of 3
1 2 3 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
792 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
779 picture button
dre-miR-451 miR-451 Danio rerio
AAACCGUUACCAUUACUGAGUU
831 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
756 picture button
dre-miR-430b miR-430 Danio rerio
AAAGUGCUAUCAAGUUGGGGUAG
803 picture button
dre-miR-181a miR-181 Danio rerio
AACAUUCAACGCUGUCGGUGAGU
826 picture button
dre-miR-181b miR-181 Danio rerio
AACAUUCAUUGCUGUCGGUGGG
853 picture button
dre-miR-100 miR-100 Danio rerio
AACCCGUAGAUCCGAACUUGUG
786 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
812 picture button
dre-miR-193b miR-193 Danio rerio
AACUGGCCCGCAAAGUCCCGCU
1027 picture button
dre-miR-193a miR-193 Danio rerio
AACUGGCCUACAAAGUCCCAGU
997 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
788 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
724 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
725 picture button
dre-miR-15c miR-15 Danio rerio
AAGCAGCGCGUCAUGGUUUUC
867 picture button
dre-miR-129* miR-129* Danio rerio
AAGCCCUUACCCCAAAAAGCAU
658 picture button
dre-miR-22a miR-22 Danio rerio
AAGCUGCCAGCUGAAGAACUGU
911 picture button
dre-miR-22b miR-22 Danio rerio
AAGCUGCCAGUUGAAGAGCUGU
929 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
680 picture button
xtr-miR-425-5p miR-425 Xenopus tropicalis
AAUGACACGAUCACUCCCGUUGA
943 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
749 picture button
dre-miR-363 miR-363 Danio rerio
AAUUGCACGGUAUCCAUCUGUA
855 picture button
xtr-miR-367 miR-367 Xenopus tropicalis
AAUUGCACUGUAGCAAUGGUGA
839 picture button
dre-miR-214 miR-214 Danio rerio
ACAGCAGGCACAGACAGGCAG
835 picture button
dre-miR-181a* miR-181* Danio rerio
ACCAUCGACCGUUGAUUGUACC
729 picture button
dre-miR-132* miR-132* Danio rerio
ACCGUGGCAUUAGAUUGUUACU
665 picture button
dre-miR-17a* miR-17* Danio rerio
ACUGCAGUGGAGGCACUUCUAG
575 picture button
dre-miR-20a* miR-20* Danio rerio
ACUGCAGUGUGAGCACUUGAAG
706 picture button
dre-miR-202 miR-202 Danio rerio
AGAGGCAUAGGGCAUGGGAAAA
748 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
739 picture button
dre-miR-107 miR-107 Danio rerio
AGCAGCAUUGUACAGGGCUAUCA
728 picture button
dre-miR-103 miR-103 Danio rerio
AGCAGCAUUGUACAGGGCUAUGA
744 picture button
dre-miR-210* miR-210* Danio rerio
AGCCACUGACUAACGCACAUUG
706 picture button
dre-miR-222 miR-222 Danio rerio
AGCUACAUCUGGCUACUGGGUCUC
850 picture button
dre-miR-221 miR-221 Danio rerio
AGCUACAUUGUCUGCUGGGUUUC
867 picture button
dre-miR-133a* miR-133* Danio rerio
AGCUGGUAAAAUGGAACCAAAU
699 picture button
dre-miR-138 miR-138 Danio rerio
AGCUGGUGUUGUGAAUCAGGCC
886 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
865 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
751 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
793 picture button
dre-miR-489 miR-489 Danio rerio
AGUGACAUCAUAUGUACGGCUGC
815 picture button
dre-miR-203b* miR-203* Danio rerio
AGUGGUUCUCAACAGUUCAACA
606 picture button
dre-miR-19b* miR-19* Danio rerio
AGUUUUGCUGGUUUGCAUUCAG
623 picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
477 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
663 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
644 picture button
dre-miR-458 miR-458 Danio rerio
AUAGCUCUUUGAAUGGUACUGC
658 picture button
dre-miR-23b miR-23 Danio rerio
AUCACAUUGCCAGGGAUUACCA
794 picture button
dre-miR-23a miR-23 Danio rerio
AUCACAUUGCCAGGGAUUUCCA
801 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
767 picture button
dre-miR-192 miR-192 Danio rerio
AUGACCUAUGAAUUGACAGCC
790 picture button
dre-miR-20b miR-20 Danio rerio
CAAAGUGCUCACAGUGCAGGUAG
800 picture button
dre-miR-17a miR-17 Danio rerio
CAAAGUGCUUACAGUGCAGGUA
851 picture button
dre-miR-10a* miR-10* Danio rerio
CAAAUUCGUGUCUUGGGGAAUA
699 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
743 picture button
dre-miR-460-3p miR-460 Danio rerio
CACAGCGCAUACAAUGUGGAUG
977 picture button
dre-miR-181c miR-181 Danio rerio
CACAUUCAUUGCUGUCGGUGGG
876 picture button
dre-miR-10d* miR-10* Danio rerio
CAGAUUCGGUUUUAGGGGAGUA
754 picture button
dre-miR-15a* miR-15* Danio rerio
CAGGCCGUACUGUGCUGCGGCA
706 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
740 picture button
dre-miR-459* miR-459* Danio rerio
CAGGGAAUCUCUGUUACUGGGG
540 picture button
dre-miR-130b miR-130 Danio rerio
CAGUGCAAUAAUGAAAGGGCAU
854 picture button
dre-miR-301a miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAAAG
870 picture button
dre-miR-301c miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAUAG
806 picture button
dre-miR-301b miR-301 Danio rerio
CAGUGCAAUAGUAUUGUCAUUG
788 picture button
dre-miR-130c miR-130 Danio rerio
CAGUGCAAUAUUAAAAGGGCAU
837 picture button
dre-miR-130a miR-130 Danio rerio
CAGUGCAAUGUUAAAAGGGCAU
849 picture button
dre-miR-140 miR-140 Danio rerio
CAGUGGUUUUACCCUAUGGUAG
725 picture button
dre-miR-142a-5p miR-142 Danio rerio
CAUAAAGUAGAAAGCACUACU
627 picture button
dre-miR-142b-5p miR-142 Danio rerio
CAUAAAGUAGACAGCACUACUA
614 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
666 picture button
dre-miR-126* miR-126* Danio rerio
CAUUAUUACUUUUGGUACGCG
521 picture button
dre-miR-25 miR-25 Danio rerio
CAUUGCACUUGUCUCGGUCUGA
871 picture button
dre-miR-220 miR-220 Danio rerio
CCACAACCGUAUCGGACACUU
924 picture button
dre-miR-199 miR-199 Danio rerio
CCCAGUGUUCAGACUACCUGUUC
866 picture button
dre-miR-460-5p miR-460 Danio rerio
CCUGCAUUGUACACACUGUGCG
772 picture button
dre-miR-19a* miR-19* Danio rerio
CUAGUUUUGCAUAGUUGCACUA
549 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
773 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
860 picture button
dre-miR-18b* miR-18* Danio rerio
CUGCCCUAAGUGCCCCUUCUGG
699 picture button
dre-miR-210 miR-210 Danio rerio
CUGUGCGUGUGACAGCGGCUAA
757 picture button
dre-miR-27c* miR-27* Danio rerio
CUUAACCCACUUGUGAACAAUG
833 picture button
dre-miR-30e* miR-30* Danio rerio
CUUUCAGUCGGAUGUUUGCAGC
578 picture button
dre-miR-129 miR-129 Danio rerio
CUUUUUGCGGUCUGGGCUUGCU
623 picture button
dre-miR-723* miR-723* Danio rerio
GACAGUUUUAAAUGAUGUUACUUU
610 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
771 picture button
dre-miR-133b* miR-133* Danio rerio
GCUGGUCAAAUGGAACCAAGUC
730 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
786 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
702 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
609 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
774 picture button
dre-miR-203b miR-203 Danio rerio
GUGAAAUGUUCAGGACCACUUG
648 picture button
dre-miR-203a miR-203 Danio rerio
GUGAAAUGUUUAGGACCACUUG
611 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
786 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
786 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
787 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
690 picture button
dre-miR-9* miR-9* Danio rerio
UAAAGCUAGAUAACCGAAAGU
661 picture button
dre-miR-20a miR-20 Danio rerio
UAAAGUGCUUAUAGUGCAGGUAG
841 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
922 picture button

Page 1 of 3
1 2 3 next >>

spacer
spacer