spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 1 of 3
1 2 3 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-let-7a let-7 Danio rerio
UGAGGUAGUAGGUUGUAUAGUU
946 picture button
dre-let-7b let-7 Danio rerio
UGAGGUAGUAGGUUGUGUGGUU
919 picture button
dre-let-7c let-7 Danio rerio
UGAGGUAGUAGGUUGUAUGGUU
951 picture button
dre-let-7d let-7 Danio rerio
UGAGGUAGUUGGUUGUAUGGUU
941 picture button
dre-let-7e let-7 Danio rerio
UGAGGUAGUAGAUUGAAUAGUU
877 picture button
dre-let-7f let-7 Danio rerio
UGAGGUAGUAGAUUGUAUAGUU
907 picture button
dre-let-7g let-7 Danio rerio
UGAGGUAGUAGUUUGUAUAGUU
903 picture button
dre-let-7h let-7 Danio rerio
UGAGGUAGUAAGUUGUGUUGUU
939 picture button
dre-let-7i let-7 Danio rerio
UGAGGUAGUAGUUUGUGCUGUU
945 picture button
dre-let-7j let-7 Danio rerio
UGAGGUAGUUGUUUGUACAGUU
998 picture button
dre-miR-1 miR-1 Danio rerio
UGGAAUGUAAAGAAGUAUGUAU
715 picture button
dre-miR-100 miR-100 Danio rerio
AACCCGUAGAUCCGAACUUGUG
786 picture button
dre-miR-101a miR-101 Danio rerio
UACAGUACUGUGAUAACUGAAG
948 picture button
dre-miR-101b miR-101 Danio rerio
UACAGUACUAUGAUAACUGAAG
942 picture button
dre-miR-103 miR-103 Danio rerio
AGCAGCAUUGUACAGGGCUAUGA
744 picture button
dre-miR-107 miR-107 Danio rerio
AGCAGCAUUGUACAGGGCUAUCA
728 picture button
dre-miR-10a miR-10 Danio rerio
UACCCUGUAGAUCCGAAUUUGU
1000 picture button
dre-miR-10a* miR-10* Danio rerio
CAAAUUCGUGUCUUGGGGAAUA
699 picture button
dre-miR-10b miR-10 Danio rerio
UACCCUGUAGAACCGAAUUUGUG
992 picture button
dre-miR-10c miR-10 Danio rerio
UACCCUGUAGAUCCGGAUUUGU
1013 picture button
dre-miR-10d miR-10 Danio rerio
UACCCUGUAGAACCGAAUGUGUG
982 picture button
dre-miR-10d* miR-10* Danio rerio
CAGAUUCGGUUUUAGGGGAGUA
754 picture button
dre-miR-122 miR-122 Danio rerio
UGGAGUGUGACAAUGGUGUUUG
762 picture button
dre-miR-124 miR-124 Danio rerio
UAAGGCACGCGGUGAAUGCCAA
834 picture button
dre-miR-125a miR-125 Danio rerio
UCCCUGAGACCCUUAACCUGUG
933 picture button
dre-miR-125b miR-125 Danio rerio
UCCCUGAGACCCUAACUUGUGA
961 picture button
dre-miR-125c miR-125 Danio rerio
UCCCUGAGACCCUAACUCGUGA
923 picture button
dre-miR-126 miR-126 Danio rerio
UCGUACCGUGAGUAAUAAUGC
777 picture button
dre-miR-126* miR-126* Danio rerio
CAUUAUUACUUUUGGUACGCG
521 picture button
dre-miR-128 miR-128 Danio rerio
UCACAGUGAACCGGUCUCUUUU
766 picture button
dre-miR-129 miR-129 Danio rerio
CUUUUUGCGGUCUGGGCUUGCU
623 picture button
dre-miR-129* miR-129* Danio rerio
AAGCCCUUACCCCAAAAAGCAU
658 picture button
dre-miR-130a miR-130 Danio rerio
CAGUGCAAUGUUAAAAGGGCAU
849 picture button
dre-miR-130b miR-130 Danio rerio
CAGUGCAAUAAUGAAAGGGCAU
854 picture button
dre-miR-130c miR-130 Danio rerio
CAGUGCAAUAUUAAAAGGGCAU
837 picture button
dre-miR-132 miR-132 Danio rerio
UAACAGUCUACAGCCAUGGUCG
848 picture button
dre-miR-132* miR-132* Danio rerio
ACCGUGGCAUUAGAUUGUUACU
665 picture button
dre-miR-133a miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUG
846 picture button
dre-miR-133a* miR-133* Danio rerio
AGCUGGUAAAAUGGAACCAAAU
699 picture button
dre-miR-133b miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUA
827 picture button
dre-miR-133b* miR-133* Danio rerio
GCUGGUCAAAUGGAACCAAGUC
730 picture button
dre-miR-133c miR-133 Danio rerio
UUUGGUCCCUUUCAACCAGCUA
860 picture button
dre-miR-135a miR-135 Danio rerio
UAUGGCUUUUUAUUCCUAUGUGA
825 picture button
dre-miR-135b miR-135 Danio rerio
UAUGGCUUUUUAUUCCUAUCUG
768 picture button
dre-miR-135c miR-135 Danio rerio
UAUGGCUUUCUAUUCCUAUGUG
805 picture button
dre-miR-137 miR-137 Danio rerio
UUAUUGCUUAAGAAUACGCGUA
883 picture button
dre-miR-138 miR-138 Danio rerio
AGCUGGUGUUGUGAAUCAGGCC
886 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
787 picture button
dre-miR-140 miR-140 Danio rerio
CAGUGGUUUUACCCUAUGGUAG
725 picture button
dre-miR-140* miR-140* Danio rerio
UACCACAGGGUAGAACCACGGAC
799 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
922 picture button
dre-miR-142a-3p miR-142 Danio rerio
UGUAGUGUUUCCUACUUUAUGGA
760 picture button
dre-miR-142a-5p miR-142 Danio rerio
CAUAAAGUAGAAAGCACUACU
627 picture button
dre-miR-142b-5p miR-142 Danio rerio
CAUAAAGUAGACAGCACUACUA
614 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
689 picture button
dre-miR-144 miR-144 Danio rerio
UACAGUAUAGAUGAUGUACU
738 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
774 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
871 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
855 picture button
dre-miR-148 miR-148 Danio rerio
UCAGUGCAUUACAGAACUUUGU
886 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
776 picture button
dre-miR-152 miR-152 Danio rerio
UCAGUGCAUGACAGAACUUUGG
912 picture button
dre-miR-153a miR-153 Danio rerio
UUGCAUAGUCACAAAAGUGAUC
781 picture button
dre-miR-153b miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAGC
776 picture button
dre-miR-153c miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAUC
741 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
800 picture button
dre-miR-15a miR-15 Danio rerio
UAGCAGCACAGAAUGGUUUGUG
847 picture button
dre-miR-15a* miR-15* Danio rerio
CAGGCCGUACUGUGCUGCGGCA
706 picture button
dre-miR-15b miR-15 Danio rerio
UAGCAGCACAUCAUGGUUUGUA
901 picture button
dre-miR-15c miR-15 Danio rerio
AAGCAGCGCGUCAUGGUUUUC
867 picture button
dre-miR-16a miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGUG
747 picture button
dre-miR-16b miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGAG
728 picture button
dre-miR-16c miR-16 Danio rerio
UAGCAGCAUGUAAAUAUUGGAG
723 picture button
dre-miR-17a miR-17 Danio rerio
CAAAGUGCUUACAGUGCAGGUA
851 picture button
dre-miR-17a* miR-17* Danio rerio
ACUGCAGUGGAGGCACUUCUAG
575 picture button
dre-miR-181a miR-181 Danio rerio
AACAUUCAACGCUGUCGGUGAGU
826 picture button
dre-miR-181a* miR-181* Danio rerio
ACCAUCGACCGUUGAUUGUACC
729 picture button
dre-miR-181b miR-181 Danio rerio
AACAUUCAUUGCUGUCGGUGGG
853 picture button
dre-miR-181c miR-181 Danio rerio
CACAUUCAUUGCUGUCGGUGGG
876 picture button
dre-miR-182 miR-182 Danio rerio
UUUGGCAAUGGUAGAACUCACA
840 picture button
dre-miR-182* miR-182* Danio rerio
UGGUUCUAGACUUGCCAACUA
647 picture button
dre-miR-183 miR-183 Danio rerio
UAUGGCACUGGUAGAAUUCACUG
857 picture button
dre-miR-184 miR-184 Danio rerio
UGGACGGAGAACUGAUAAGGGC
841 picture button
dre-miR-187 miR-187 Danio rerio
UCGUGUCUUGUGUUGCAGCC
648 picture button
dre-miR-18a miR-18 Danio rerio
UAAGGUGCAUCUAGUGCAGAUA
772 picture button
dre-miR-18b miR-18 Danio rerio
UAAGGUGCAUUUAGUGCAGAUA
826 picture button
dre-miR-18b* miR-18* Danio rerio
CUGCCCUAAGUGCCCCUUCUGG
699 picture button
dre-miR-18c miR-18 Danio rerio
UAAGGUGCAUCUUGUGUAGUUA
744 picture button
dre-miR-190 miR-190 Danio rerio
UGAUAUGUUUGAUAUAUUAGGU
723 picture button
dre-miR-190b miR-190 Danio rerio
UGAUAUGUUUGAUAUUCGGUUG
746 picture button
dre-miR-192 miR-192 Danio rerio
AUGACCUAUGAAUUGACAGCC
790 picture button
dre-miR-193a miR-193 Danio rerio
AACUGGCCUACAAAGUCCCAGU
997 picture button
dre-miR-193b miR-193 Danio rerio
AACUGGCCCGCAAAGUCCCGCU
1027 picture button
dre-miR-194a miR-194 Danio rerio
UGUAACAGCAACUCCAUGUGG
786 picture button
dre-miR-194b miR-194 Danio rerio
UGUAACAGCCGCUCCAUGUGGA
796 picture button
dre-miR-196a miR-196 Danio rerio
UAGGUAGUUUCAUGUUGUUGGG
807 picture button
dre-miR-196b miR-196 Danio rerio
UAGGUAGUUUCAAGUUGUUGGG
779 picture button
dre-miR-199 miR-199 Danio rerio
CCCAGUGUUCAGACUACCUGUUC
866 picture button
dre-miR-199* miR-199* Danio rerio
UACAGUAGUCUGCACAUUGGUU
648 picture button
dre-miR-19a miR-19 Danio rerio
UGUGCAAAUCUAUGCAAAACUGA
749 picture button

Page 1 of 3
1 2 3 next >>

spacer
spacer