spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 1 of 3
1 2 3 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-let-7d let-7 Danio rerio
UGAGGUAGUUGGUUGUAUGGUU
941 picture button
dre-let-7a let-7 Danio rerio
UGAGGUAGUAGGUUGUAUAGUU
946 picture button
dre-let-7i let-7 Danio rerio
UGAGGUAGUAGUUUGUGCUGUU
945 picture button
dre-let-7f let-7 Danio rerio
UGAGGUAGUAGAUUGUAUAGUU
907 picture button
dre-let-7c let-7 Danio rerio
UGAGGUAGUAGGUUGUAUGGUU
951 picture button
dre-let-7h let-7 Danio rerio
UGAGGUAGUAAGUUGUGUUGUU
939 picture button
dre-let-7e let-7 Danio rerio
UGAGGUAGUAGAUUGAAUAGUU
877 picture button
dre-let-7b let-7 Danio rerio
UGAGGUAGUAGGUUGUGUGGUU
919 picture button
dre-let-7j let-7 Danio rerio
UGAGGUAGUUGUUUGUACAGUU
998 picture button
dre-let-7g let-7 Danio rerio
UGAGGUAGUAGUUUGUAUAGUU
903 picture button
dre-miR-1 miR-1 Danio rerio
UGGAAUGUAAAGAAGUAUGUAU
715 picture button
dre-miR-7b miR-7 Danio rerio
UGGAAGACUUGUGAUUUUGUU
711 picture button
dre-miR-7a miR-7 Danio rerio
UGGAAGACUAGUGAUUUUGUUGU
686 picture button
dre-miR-9 miR-9 Danio rerio
UCUUUGGUUAUCUAGCUGUAUGA
685 picture button
dre-miR-9* miR-9* Danio rerio
UAAAGCUAGAUAACCGAAAGU
661 picture button
dre-miR-10a miR-10 Danio rerio
UACCCUGUAGAUCCGAAUUUGU
1000 picture button
dre-miR-10d* miR-10* Danio rerio
CAGAUUCGGUUUUAGGGGAGUA
754 picture button
dre-miR-10c miR-10 Danio rerio
UACCCUGUAGAUCCGGAUUUGU
1013 picture button
dre-miR-10a* miR-10* Danio rerio
CAAAUUCGUGUCUUGGGGAAUA
699 picture button
dre-miR-10b miR-10 Danio rerio
UACCCUGUAGAACCGAAUUUGUG
992 picture button
dre-miR-10d miR-10 Danio rerio
UACCCUGUAGAACCGAAUGUGUG
982 picture button
dre-miR-15a* miR-15* Danio rerio
CAGGCCGUACUGUGCUGCGGCA
706 picture button
dre-miR-15a miR-15 Danio rerio
UAGCAGCACAGAAUGGUUUGUG
847 picture button
dre-miR-15c miR-15 Danio rerio
AAGCAGCGCGUCAUGGUUUUC
867 picture button
dre-miR-15b miR-15 Danio rerio
UAGCAGCACAUCAUGGUUUGUA
901 picture button
dre-miR-16b miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGAG
728 picture button
dre-miR-16a miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGUG
747 picture button
dre-miR-16c miR-16 Danio rerio
UAGCAGCAUGUAAAUAUUGGAG
723 picture button
dre-miR-17a* miR-17* Danio rerio
ACUGCAGUGGAGGCACUUCUAG
575 picture button
dre-miR-17a miR-17 Danio rerio
CAAAGUGCUUACAGUGCAGGUA
851 picture button
dre-miR-18b miR-18 Danio rerio
UAAGGUGCAUUUAGUGCAGAUA
826 picture button
dre-miR-18b* miR-18* Danio rerio
CUGCCCUAAGUGCCCCUUCUGG
699 picture button
dre-miR-18a miR-18 Danio rerio
UAAGGUGCAUCUAGUGCAGAUA
772 picture button
dre-miR-18c miR-18 Danio rerio
UAAGGUGCAUCUUGUGUAGUUA
744 picture button
dre-miR-19b miR-19 Danio rerio
UGUGCAAAUCCAUGCAAAACUGA
814 picture button
dre-miR-19d miR-19 Danio rerio
UGUGCAAACCCAUGCAAAACUGA
799 picture button
dre-miR-19a miR-19 Danio rerio
UGUGCAAAUCUAUGCAAAACUGA
749 picture button
dre-miR-19b* miR-19* Danio rerio
AGUUUUGCUGGUUUGCAUUCAG
623 picture button
dre-miR-19c miR-19 Danio rerio
UGUGCAAAUCCAUGCAAAACUCG
745 picture button
dre-miR-19a* miR-19* Danio rerio
CUAGUUUUGCAUAGUUGCACUA
549 picture button
dre-miR-20b miR-20 Danio rerio
CAAAGUGCUCACAGUGCAGGUAG
800 picture button
dre-miR-20a miR-20 Danio rerio
UAAAGUGCUUAUAGUGCAGGUAG
841 picture button
dre-miR-20a* miR-20* Danio rerio
ACUGCAGUGUGAGCACUUGAAG
706 picture button
dre-miR-21 miR-21 Danio rerio
UAGCUUAUCAGACUGGUGUUGGC
734 picture button
dre-miR-22b miR-22 Danio rerio
AAGCUGCCAGUUGAAGAGCUGU
929 picture button
dre-miR-22a miR-22 Danio rerio
AAGCUGCCAGCUGAAGAACUGU
911 picture button
dre-miR-23a miR-23 Danio rerio
AUCACAUUGCCAGGGAUUUCCA
801 picture button
dre-miR-23b miR-23 Danio rerio
AUCACAUUGCCAGGGAUUACCA
794 picture button
dre-miR-24 miR-24 Danio rerio
UGGCUCAGUUCAGCAGGAACAG
794 picture button
dre-miR-25 miR-25 Danio rerio
CAUUGCACUUGUCUCGGUCUGA
871 picture button
dre-miR-26b miR-26 Danio rerio
UUCAAGUAAUCCAGGAUAGGUU
782 picture button
dre-miR-26a miR-26 Danio rerio
UUCAAGUAAUCCAGGAUAGGCU
828 picture button
dre-miR-27a miR-27 Danio rerio
UUCACAGUGGCUAAGUUCCGCU
789 picture button
dre-miR-27c* miR-27* Danio rerio
CUUAACCCACUUGUGAACAAUG
833 picture button
dre-miR-27c miR-27 Danio rerio
UUCACAGUGGUUAAGUUCUGC
791 picture button
dre-miR-27e miR-27 Danio rerio
UUCACAGUGGCUAAGUUCAGUG
788 picture button
dre-miR-27b miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUGCA
741 picture button
dre-miR-27d miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUUCA
764 picture button
dre-miR-29b miR-29 Danio rerio
UAGCACCAUUUGAAAUCAGUGU
905 picture button
dre-miR-29a miR-29 Danio rerio
UAGCACCAUUUGAAAUCGGUUA
943 picture button
dre-miR-30a miR-30 Danio rerio
UGUAAACAUUCCCGACUGGAAG
764 picture button
dre-miR-30e* miR-30* Danio rerio
CUUUCAGUCGGAUGUUUGCAGC
578 picture button
dre-miR-30c miR-30 Danio rerio
UGUAAACAUCCUACACUCUCAG
748 picture button
dre-miR-30e miR-30 Danio rerio
UGUAAACAUCCUUGACUGGAAG
789 picture button
dre-miR-30b miR-30 Danio rerio
UGUAAACAUCCUACACUCAGCU
763 picture button
dre-miR-30d miR-30 Danio rerio
UGUAAACAUCCCCGACUGGAAG
713 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
786 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
865 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
865 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
904 picture button
dre-miR-92b miR-92 Danio rerio
UAUUGCACUCGUCCCGGCCUCC
840 picture button
dre-miR-92a miR-92 Danio rerio
UAUUGCACUUGUCCCGGCCUGU
906 picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
792 picture button
dre-miR-96 miR-96 Danio rerio
UUUGGCACUAGCACAUUUUUGCU
866 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
812 picture button
dre-miR-100 miR-100 Danio rerio
AACCCGUAGAUCCGAACUUGUG
786 picture button
dre-miR-101b miR-101 Danio rerio
UACAGUACUAUGAUAACUGAAG
942 picture button
dre-miR-101a miR-101 Danio rerio
UACAGUACUGUGAUAACUGAAG
948 picture button
dre-miR-103 miR-103 Danio rerio
AGCAGCAUUGUACAGGGCUAUGA
744 picture button
dre-miR-107 miR-107 Danio rerio
AGCAGCAUUGUACAGGGCUAUCA
728 picture button
dre-miR-122 miR-122 Danio rerio
UGGAGUGUGACAAUGGUGUUUG
762 picture button
dre-miR-124 miR-124 Danio rerio
UAAGGCACGCGGUGAAUGCCAA
834 picture button
dre-miR-125c miR-125 Danio rerio
UCCCUGAGACCCUAACUCGUGA
923 picture button
dre-miR-125b miR-125 Danio rerio
UCCCUGAGACCCUAACUUGUGA
961 picture button
dre-miR-125a miR-125 Danio rerio
UCCCUGAGACCCUUAACCUGUG
933 picture button
dre-miR-126* miR-126* Danio rerio
CAUUAUUACUUUUGGUACGCG
521 picture button
dre-miR-126 miR-126 Danio rerio
UCGUACCGUGAGUAAUAAUGC
777 picture button
dre-miR-128 miR-128 Danio rerio
UCACAGUGAACCGGUCUCUUUU
766 picture button
dre-miR-129* miR-129* Danio rerio
AAGCCCUUACCCCAAAAAGCAU
658 picture button
dre-miR-129 miR-129 Danio rerio
CUUUUUGCGGUCUGGGCUUGCU
623 picture button
dre-miR-130c miR-130 Danio rerio
CAGUGCAAUAUUAAAAGGGCAU
837 picture button
dre-miR-130b miR-130 Danio rerio
CAGUGCAAUAAUGAAAGGGCAU
854 picture button
dre-miR-130a miR-130 Danio rerio
CAGUGCAAUGUUAAAAGGGCAU
849 picture button
dre-miR-132* miR-132* Danio rerio
ACCGUGGCAUUAGAUUGUUACU
665 picture button
dre-miR-132 miR-132 Danio rerio
UAACAGUCUACAGCCAUGGUCG
848 picture button
dre-miR-133c miR-133 Danio rerio
UUUGGUCCCUUUCAACCAGCUA
860 picture button
dre-miR-133b* miR-133* Danio rerio
GCUGGUCAAAUGGAACCAAGUC
730 picture button
dre-miR-133b miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUA
827 picture button
dre-miR-133a* miR-133* Danio rerio
AGCUGGUAAAAUGGAACCAAAU
699 picture button
dre-miR-133a miR-133 Danio rerio
UUUGGUCCCCUUCAACCAGCUG
846 picture button

Page 1 of 3
1 2 3 next >>

spacer
spacer