spacer

MicroRNA Listing for Tetraodon nigroviridis


174 microRNAs (109 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
tni-let-7d let-7 Tetraodon nigroviridis
UGAGGUAGUUGGUUGUAUGGUU
839 picture button
tni-let-7j let-7 Tetraodon nigroviridis
UGAGGUAGUUUUUUGUACAGUU
872 picture button
tni-let-7g let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUAUAGUU
825 picture button
tni-let-7b let-7 Tetraodon nigroviridis
UGAGGUAGUAGGUUGUGUGGUU
873 picture button
tni-let-7i let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUGCUGUU
867 picture button
tni-let-7e let-7 Tetraodon nigroviridis
UGAGGUAGUAGAUUGAAUAGUU
808 picture button
tni-let-7a let-7 Tetraodon nigroviridis
UGAGGUAGUAGGUUGUAUAGUU
844 picture button
tni-let-7h let-7 Tetraodon nigroviridis
UGAGGUAGUAAGUUGUGUUGUU
834 picture button
tni-miR-1 miR-1 Tetraodon nigroviridis
UGGAAUGUAAAGAAGUAUGUAU
697 picture button
tni-miR-7 miR-7 Tetraodon nigroviridis
UGGAAGACUAGUGAUUUUGUUGU
755 picture button
tni-miR-9 miR-9 Tetraodon nigroviridis
UCUUUGGUUAUCUAGCUGUAUGA
699 picture button
tni-miR-10c miR-10 Tetraodon nigroviridis
UACCCUGUAGAUCCGGAUUUGU
913 picture button
tni-miR-10b miR-10 Tetraodon nigroviridis
UACCCUGUAGAACCGAAUUUGUG
914 picture button
tni-miR-10d miR-10 Tetraodon nigroviridis
UACCCUGUAGAACCGAAUGUGUGUG
912 picture button
tni-miR-15b miR-15 Tetraodon nigroviridis
UAGCAGCGCAUCAUGGUUUGUA
826 picture button
tni-miR-15a miR-15 Tetraodon nigroviridis
UAGCAGCACGGAAUGGUUUGUG
852 picture button
tni-miR-16 miR-16 Tetraodon nigroviridis
UAGCAGCACGUAAAUAUUGGAG
815 picture button
tni-miR-17 miR-17 Tetraodon nigroviridis
CAAAGUGCUUACAGUGCAGGUA
952 picture button
tni-miR-18 miR-18 Tetraodon nigroviridis
UAAGGUGCAUCUAGUGCAGAUA
867 picture button
tni-miR-19b miR-19 Tetraodon nigroviridis
UGUGCAAAUCCAUGCAAAACUGA
817 picture button
tni-miR-19a miR-19 Tetraodon nigroviridis
UGUGCAAAUCUAUGCAAAACUGA
861 picture button
tni-miR-20 miR-20 Tetraodon nigroviridis
UAAAGUGCUUAUAGUGCAGGUAG
901 picture button
tni-miR-21 miR-21 Tetraodon nigroviridis
UAGCUUAUCAGACUGGUGUUGGC
853 picture button
tni-miR-22a miR-22 Tetraodon nigroviridis
AAGCUGCCAGCUGAAGAACUGU
883 picture button
tni-miR-22b miR-22 Tetraodon nigroviridis
AAGCUGCCAGUUGAAGAGCUGU
857 picture button
tni-miR-23a miR-23 Tetraodon nigroviridis
AUCACAUUGCCAGGGAUUUCCA
838 picture button
tni-miR-23b miR-23 Tetraodon nigroviridis
AUCACAUUGCCAGGGAUUACCA
830 picture button
tni-miR-24 miR-24 Tetraodon nigroviridis
UGGCUCAGUUCAGCAGGAACAG
861 picture button
tni-miR-25 miR-25 Tetraodon nigroviridis
CAUUGCACUUGUCUCGGUCUGA
867 picture button
tni-miR-26 miR-26 Tetraodon nigroviridis
UUCAAGUAAUCCAGGAUAGGCU
822 picture button
tni-miR-27b miR-27 Tetraodon nigroviridis
UUCACAGUGGCUAAGUUCUGCA
935 picture button
tni-miR-27e miR-27 Tetraodon nigroviridis
UUCACAGUGGCUAAGUUCAGUG
915 picture button
tni-miR-27c miR-27 Tetraodon nigroviridis
UUCACAGUGGUUAAGUUCUGC
970 picture button
tni-miR-29a miR-29 Tetraodon nigroviridis
UAGCACCAUUUGAAAUCGGUUA
899 picture button
tni-miR-29b miR-29 Tetraodon nigroviridis
UAGCACCAUUUGAAAUCAGUGU
906 picture button
tni-miR-30b miR-30 Tetraodon nigroviridis
UGUAAACAUCCUACACUCAGCU
889 picture button
tni-miR-30d miR-30 Tetraodon nigroviridis
UGUAAACAUCCCCGACUGGAAG
889 picture button
tni-miR-30c miR-30 Tetraodon nigroviridis
UGUAAACAUCCUACACUCUCGG
872 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
776 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
900 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
909 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
860 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
887 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
863 picture button
tni-miR-92 miR-92 Tetraodon nigroviridis
UAUUGCACUUGUCCCGGCCUGU
930 picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
949 picture button
tni-miR-96 miR-96 Tetraodon nigroviridis
UUUGGCACUAGCACAUUUUUGCU
915 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
666 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
758 picture button
tni-miR-100 miR-100 Tetraodon nigroviridis
AACCCGUAGAUCCGAACUUGUG
714 picture button
tni-miR-101b miR-101 Tetraodon nigroviridis
UACAGUACUAUGAUAACUGAAG
880 picture button
tni-miR-101a miR-101 Tetraodon nigroviridis
UACAGUACUGUGAUAACUGAAG
915 picture button
tni-miR-103 miR-103 Tetraodon nigroviridis
AGCAGCAUUGUACAGGGCUAUGA
789 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
901 picture button
tni-miR-107 miR-107 Tetraodon nigroviridis
AGCAGCAUUGUACAGGGCUAUCA
775 picture button
tni-miR-122 miR-122 Tetraodon nigroviridis
UGGAGUGUGACAAUGGUGUUUG
751 picture button
tni-miR-124 miR-124 Tetraodon nigroviridis
UAAGGCACGCGGUGAAUGCCAA
884 picture button
tni-miR-125a miR-125 Tetraodon nigroviridis
UCCCUGAGACCCUUAACCUGUG
922 picture button
tni-miR-125b miR-125 Tetraodon nigroviridis
UCCCUGAGACCCUAACUUGUGA
939 picture button
tni-miR-126 miR-126 Tetraodon nigroviridis
UCGUACCGUGAGUAAUAAUGC
766 picture button
tni-miR-128 miR-128 Tetraodon nigroviridis
UCACAGUGAACCGGUCUCUUUU
898 picture button
tni-miR-129 miR-129 Tetraodon nigroviridis
CUUUUUGCGGUCUGGGCUUGCU
684 picture button
tni-miR-130 miR-130 Tetraodon nigroviridis
CAGUGCAAUAUUAAAAGGGCAU
874 picture button
tni-miR-132 miR-132 Tetraodon nigroviridis
UAACAGUCUACAGCCAUGGUCG
932 picture button
tni-miR-133 miR-133 Tetraodon nigroviridis
UUUGGUCCCCUUCAACCAGCUG
794 picture button
tni-miR-135a miR-135 Tetraodon nigroviridis
UAUGGCUUUCUAUUCCUAUGUG
853 picture button
tni-miR-135b miR-135 Tetraodon nigroviridis
UAUGGCUUUUUAUUCCUAUCUG
889 picture button
tni-miR-137 miR-137 Tetraodon nigroviridis
UUAUUGCUUGAGAAUACGCGUA
859 picture button
tni-miR-138 miR-138 Tetraodon nigroviridis
AGCUGGUGUUGUGAAUCAGGCC
776 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
876 picture button
tni-miR-140 miR-140 Tetraodon nigroviridis
CAGUGGUUUUACCCUAUGGUAG
795 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
989 picture button
tni-miR-142b miR-142 Tetraodon nigroviridis
CAUAAAGUAGAAAGCACUACUA
578 picture button
tni-miR-142a miR-142 Tetraodon nigroviridis
CAUAAAGUAGAAAGCACUACU
552 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
688 picture button
tni-miR-144 miR-144 Tetraodon nigroviridis
UACAGUAUAGAUGAUGUACU
906 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
845 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
846 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
826 picture button
tni-miR-148 miR-148 Tetraodon nigroviridis
UCAGUGCAUUACAGAACUUUGU
969 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
773 picture button
tni-miR-152 miR-152 Tetraodon nigroviridis
UCAGUGCAUAACAGAACUUUGU
946 picture button
tni-miR-153a miR-153 Tetraodon nigroviridis
UUGCAUAGUCACAAAAGUGAUC
848 picture button
tni-miR-153b miR-153 Tetraodon nigroviridis
UUGCAUAGUCACAAAAAUGAGC
861 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
857 picture button
tni-miR-181a* miR-181* Tetraodon nigroviridis
ACCAUCGACCGUUGAUUGUACC
805 picture button
tni-miR-181b miR-181 Tetraodon nigroviridis
AACAUUCAUUGCUGUCGGUGGG
1078 picture button
tni-miR-181a miR-181 Tetraodon nigroviridis
AACAUUCAACGCUGUCGGUGAGU
1054 picture button
tni-miR-182 miR-182 Tetraodon nigroviridis
UGGUUCUAGACUUGCCAACUA
809 picture button
tni-miR-183 miR-183 Tetraodon nigroviridis
UAUGGCACUGGUAGAAUUCACUG
868 picture button
tni-miR-184 miR-184 Tetraodon nigroviridis
UGGACGGAGAACUGAUAAGGG
790 picture button
tni-miR-187 miR-187 Tetraodon nigroviridis
UCGUGUCUUGUGUUGCAGCC
726 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
805 picture button
tni-miR-190 miR-190 Tetraodon nigroviridis
UGAUAUGUUUGAUAUAUUAGGU
690 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
743 picture button
tni-miR-192 miR-192 Tetraodon nigroviridis
AUGACCUAUGAAUUGACAGCC
781 picture button
tni-miR-193 miR-193 Tetraodon nigroviridis
AACUGGCCUACAAAGUCCCAGU
864 picture button
tni-miR-194 miR-194 Tetraodon nigroviridis
UGUAACAGCAACUCCAUGUGG
789 picture button
tni-miR-196a miR-196 Tetraodon nigroviridis
UAGGUAGUUUCAUGUUGUUGGG
793 picture button
tni-miR-196b miR-196 Tetraodon nigroviridis
UAGGUAGUUUCAAGUUGUUGGG
778 picture button

Page 1 of 2
1 2 next >>

spacer
spacer