spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 7 of 7
<< prev 1 2 3 4 5 6 7

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
948 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
756 picture button
mmu-miR-699 miR-699 Mus musculus
AGGCAGUGCGACCUGGCUCG
910 picture button
mmu-miR-700 miR-700 Mus musculus
CACGCGGGAACCGAGUCCACC
824 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
846 picture button
mmu-miR-702 miR-702 Mus musculus
UGCCCACCCUUUACCCCGCUC
924 picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
939 picture button
mmu-miR-704 miR-704 Mus musculus
AGACAUGUGCUCUGCUCCUAG
821 picture button
mmu-miR-705 miR-705 Mus musculus
GGUGGGAGGUGGGGUGGGCA
837 picture button
mmu-miR-706 miR-706 Mus musculus
AGAGAAACCCUGUCUCAAAAAA
912 picture button
mmu-miR-707 miR-707 Mus musculus
CAGUCAUGCCGCUUGCCUACG
839 picture button
rno-miR-708* miR-708* Rattus norvegicus
CAACUAGACUGUGAGCUUCUAG
807 picture button
rno-miR-708 miR-708 Rattus norvegicus
AAGGAGCUUACAAUCUAGCUGGG
709 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
970 picture button
mmu-miR-710 miR-710 Mus musculus
CCAAGUCUUGGGGAGAGUUGAG
930 picture button
mmu-miR-711 miR-711 Mus musculus
GGGACCCGGGGAGAGAUGUAAG
795 picture button
mmu-miR-712 miR-712 Mus musculus
CUCCUUCACCCGGGCGGUACC
807 picture button
mmu-miR-713 miR-713 Mus musculus
UGCACUGAAGGCACACAGC
911 picture button
mmu-miR-714 miR-714 Mus musculus
CGACGAGGGCCGGUCGGUCGC
867 picture button
mmu-miR-715 miR-715 Mus musculus
CUCCGUGCACACCCCCGCGUG
903 picture button
mmu-miR-717 miR-717 Mus musculus
CUCAGACAGAGAUACCUUCUCU
839 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
818 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
784 picture button
mmu-miR-720 miR-720 Mus musculus
AUCUCGCUGGGGCCUCCA
807 picture button
mmu-miR-721 miR-721 Mus musculus
CAGUGCAAUUAAAAGGGGGAA
929 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
613 picture button
rno-miR-742 miR-742 Rattus norvegicus
GAAAGCCACCAUGUUGGGUAAA
872 picture button
rno-miR-743b miR-743 Rattus norvegicus
GAAAGACACCAUACUGAAUAGA
846 picture button
rno-miR-743a miR-743 Rattus norvegicus
GAAAGACGCCAAACUGGGUAGA
876 picture button
mmu-miR-744 miR-744 Mus musculus
UGCGGGGCUAGGGCUAACAGCA
893 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
905 picture button
rno-miR-758 miR-758 Rattus norvegicus
UUUGUGACCUGGUCCACUAACC
922 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
763 picture button
rno-miR-760-3p miR-760 Rattus norvegicus
CGGCUCUGGGUCUGUGGGGA
744 picture button
rno-miR-760-5p miR-760 Rattus norvegicus
CCCCUCAGGCCACCAGAGCCCG
815 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
736 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
721 picture button
mmu-miR-763 miR-763 Mus musculus
CCAGCUGGGAAGAACCAGUGGC
789 picture button
mmu-miR-764-5p miR-764 Mus musculus
GGUGCUCACAUGUCCUCCU
981 picture button
mmu-miR-764-3p miR-764 Mus musculus
AGGAGGCCAUAGUGGCAACUGU
910 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
653 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
815 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
1005 picture button
hsa-miR-767-3p miR-767 Homo sapiens
UCUGCUCAUACCCCAUGGUUUCU
1084 picture button
hsa-miR-768-3p miR-768 Homo sapiens
UCACAAUGCUGACACUCAAACUGCUGAC
1013 picture button
hsa-miR-768-5p miR-768 Homo sapiens
GUUGGAGGAUGAAAGUACGGAGUGAU
812 picture button
hsa-miR-769-5p miR-769 Homo sapiens
UGAGACCUCUGGGUUCUGAGCU
958 picture button
hsa-miR-769-3p miR-769 Homo sapiens
CUGGGAUCUCCGGGGUCUUGGUU
979 picture button
rno-miR-770 miR-770 Rattus norvegicus
AGCACCACGUGUCUGGGCCACG
984 picture button
mmu-miR-801 miR-801 Mus musculus
GAUUGCUGUGCGUGCGGAAUCGAC
772 picture button
mmu-miR-802 miR-802 Mus musculus
UCAGUAACAAAGAUUCAUCCUU
932 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
780 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
707 picture button
rno-miR-871 miR-871 Rattus norvegicus
UAUUCAGAUUGGUGCCGGUCACA
855 picture button
rno-miR-872* miR-872* Rattus norvegicus
UGAACUAUUGCAGUAGCCUCCU
688 picture button
rno-miR-872 miR-872 Rattus norvegicus
AAGGUUACUUGUUAGUUCAGG
797 picture button
rno-miR-873 miR-873 Rattus norvegicus
GCAGGAACUUGUGAGUCUCCU
931 picture button
rno-miR-874 miR-874 Rattus norvegicus
CUGCCCUGGCCCGAGGGACCGA
936 picture button
mmu-miR-875-5p miR-875 Mus musculus
UAUACCUCAGUUUUAUCAGGUG
969 picture button
mmu-miR-875-3p miR-875 Mus musculus
CCUGAAAAUACUGAGGCUAUG
961 picture button
mmu-miR-876-3p miR-876 Mus musculus
UAGUGGUUUACAAAGUAAUUCA
881 picture button
mmu-miR-876-5p miR-876 Mus musculus
UGGAUUUCUCUGUGAAUCACUA
829 picture button
rno-miR-877 miR-877 Rattus norvegicus
GUAGAGGAGAUGGCGCAGGG
677 picture button
rno-miR-878 miR-878 Rattus norvegicus
GCAUGACACCAUACUGGGUAGA
1053 picture button
rno-miR-879 miR-879 Rattus norvegicus
AGAGGCUUAUAGCUCUAAGCC
664 picture button
rno-miR-880 miR-880 Rattus norvegicus
UACUCCAUUCAUUCUGAGUAGA
832 picture button
rno-miR-881 miR-881 Rattus norvegicus
AACUGUGGCAUUUCUGAAUAGA
736 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
615 picture button
rno-miR-883 miR-883 Rattus norvegicus
UAACUGCAACAUCUCUCAGUAU
1087 picture button
hsa-miR-885-5p miR-885 Homo sapiens
UCCAUUACACUACCCUGCCUCU
1018 picture button
hsa-miR-885-3p miR-885 Homo sapiens
AGGCAGCGGGGUGUAGUGGAUA
1219 picture button
hsa-miR-886-3p miR-886 Homo sapiens
CGCGGGUGCUUACUGACCCUU
945 picture button
hsa-miR-886-5p miR-886 Homo sapiens
CGGGUCGGAGUUAGCUCAAGCGG
885 picture button
hsa-miR-887 miR-887 Homo sapiens
GUGAACGGGCGCCAUCCCGAGG
848 picture button
hsa-miR-888 miR-888 Homo sapiens
UACUCAAAAAGCUGUCAGUCA
861 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
826 picture button
hsa-miR-890 miR-890 Homo sapiens
UACUUGGAAAGGCAUCAGUUG
868 picture button
hsa-miR-891b miR-891 Homo sapiens
UGCAACUUACCUGAGUCAUUGA
1053 picture button
hsa-miR-891a miR-891 Homo sapiens
UGCAACGAACCUGAGCCACUGA
961 picture button
hsa-miR-892a miR-892 Homo sapiens
CACUGUGUCCUUUCUGCGUAG
956 picture button
hsa-miR-892b miR-892 Homo sapiens
CACUGGCUCCUUUCUGGGUAGA
999 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
658 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
742 picture button
hsa-miR-922 miR-922 Homo sapiens
GCAGCAGAGAAUAGGACUACGUC
773 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
874 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
768 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
829 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
855 picture button
hsa-miR-935 miR-935 Homo sapiens
CCAGUUACCGCUUCCGCUACCGC
932 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
768 picture button
hsa-miR-937 miR-937 Homo sapiens
AUCCGCGCUCUGACUCUCUGCC
847 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
810 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
754 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
701 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
843 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
531 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
870 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
774 picture button

Page 7 of 7
<< prev 1 2 3 4 5 6 7

spacer
spacer