spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
901 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
849 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
764 picture button
hsa-miR-609 miR-609 Homo sapiens
AGGGUGUUUCUCUCAUCUCU
810 picture button
hsa-miR-610 miR-610 Homo sapiens
UGAGCUAAAUGUGUGCUGGGA
845 picture button
hsa-miR-611 miR-611 Homo sapiens
GCGAGGACCCCUCGGGGUCUGAC
782 picture button
hsa-miR-612 miR-612 Homo sapiens
GCUGGGCAGGGCUUCUGAGCUCCUU
884 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
747 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
924 picture button
mmu-miR-615-5p miR-615 Mus musculus
GGGGGUCCCCGGUGCUCGGAUC
811 picture button
mmu-miR-615-3p miR-615 Mus musculus
UCCGAGCCUGGGUCUCCCUCUU
1092 picture button
hsa-miR-616 miR-616 Homo sapiens
AGUCAUUGGAGGGUUUGAGCAG
800 picture button
hsa-miR-617 miR-617 Homo sapiens
AGACUUCCCAUUUGAAGGUGGC
1006 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
845 picture button
hsa-miR-619 miR-619 Homo sapiens
GACCUGGACAUGUUUGUGCCCAGU
864 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
664 picture button
hsa-miR-621 miR-621 Homo sapiens
GGCUAGCAACAGCGCUUACCU
824 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
922 picture button
hsa-miR-623 miR-623 Homo sapiens
AUCCCUUGCAGGGGCUGUUGGGU
888 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
867 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
571 picture button
hsa-miR-626 miR-626 Homo sapiens
AGCUGUCUGAAAAUGUCUU
771 picture button
hsa-miR-627 miR-627 Homo sapiens
GUGAGUCUCUAAGAAAAGAGGA
855 picture button
hsa-miR-628-3p miR-628 Homo sapiens
UCUAGUAAGAGUGGCAGUCGA
973 picture button
hsa-miR-628-5p miR-628 Homo sapiens
AUGCUGACAUAUUUACUAGAGG
1126 picture button
hsa-miR-629 miR-629 Homo sapiens
UGGGUUUACGUUGGGAGAACU
837 picture button
hsa-miR-630 miR-630 Homo sapiens
AGUAUUCUGUACCAGGGAAGGU
800 picture button
hsa-miR-631 miR-631 Homo sapiens
AGACCUGGCCCAGACCUCAGC
820 picture button
hsa-miR-632 miR-632 Homo sapiens
GUGUCUGCUUCCUGUGGGA
907 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
761 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
916 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
787 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
916 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
692 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
786 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
879 picture button
hsa-miR-640 miR-640 Homo sapiens
AUGAUCCAGGAACCUGCCUCU
953 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
766 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
755 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
735 picture button
hsa-miR-644 miR-644 Homo sapiens
AGUGUGGCUUUCUUAGAGC
933 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
818 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
947 picture button
hsa-miR-647 miR-647 Homo sapiens
GUGGCUGCACUCACUUCCUUC
1171 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
931 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
1017 picture button
hsa-miR-650 miR-650 Homo sapiens
AGGAGGCAGCGCUCUCAGGAC
766 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
631 picture button
rno-miR-652 miR-652 Rattus norvegicus
AAUGGCGCCACUAGGGUUGUG
949 picture button
mmu-miR-653 miR-653 Mus musculus
GUGUUGAAACAAUCUCUACUG
996 picture button
mmu-miR-654-3p miR-654 Mus musculus
UAUGUCUGCUGACCAUCACCUU
885 picture button
mmu-miR-654-5p miR-654 Mus musculus
UGGUAAGCUGCAGAACAUGUGU
930 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
830 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
709 picture button
hsa-miR-657 miR-657 Homo sapiens
GGCAGGUUCUCACCCUCUCUAGG
828 picture button
hsa-miR-658 miR-658 Homo sapiens
GGCGGAGGGAAGUAGGUCCGUUGGU
877 picture button
hsa-miR-659 miR-659 Homo sapiens
CUUGGUUCAGGGAGGGUCCCCA
787 picture button
bta-miR-660 miR-660 Bos taurus
UACCCAUUGCAUAUCGGAGCUG
930 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
692 picture button
hsa-miR-662 miR-662 Homo sapiens
UCCCACGUUGUGGCCCAGCAG
912 picture button
hsa-miR-663 miR-663 Homo sapiens
AGGCGGGGCGCCGCGGGACCGC
854 picture button
rno-miR-664 miR-664 Rattus norvegicus
UAUUCAUUUACUCCCCAGCCUA
795 picture button
mmu-miR-665 miR-665 Mus musculus
ACCAGGAGGCUGAGGUCCCU
798 picture button
mmu-miR-666-3p miR-666 Mus musculus
GGCUGCAGCGUGAUCGCCUGCU
1013 picture button
mmu-miR-666-5p miR-666 Mus musculus
AGCGGGCACAGCUGUGAGAGCC
1054 picture button
mmu-miR-667 miR-667 Mus musculus
UGACACCUGCCACCCAGCCCAAG
950 picture button
mmu-miR-668 miR-668 Mus musculus
UGUCACUCGGCUCGGCCCACUACC
875 picture button
mmu-miR-669b miR-669 Mus musculus
AGUUUUGUGUGCAUGUGCAUGU
866 picture button
mmu-miR-669a miR-669 Mus musculus
AGUUGUGUGUGCAUGUUCAUGU
829 picture button
mmu-miR-669c miR-669 Mus musculus
AUAGUUGUGUGUGGAUGUGUGU
929 picture button
mmu-miR-670 miR-670 Mus musculus
AUCCCUGAGUGUAUGUGGUGAA
970 picture button
rno-miR-671 miR-671 Rattus norvegicus
UCCGGUUCUCAGGGCUCCACC
982 picture button
rno-miR-672 miR-672 Rattus norvegicus
UGAGGUUGGUGUACUGUGUGUGA
732 picture button
rno-miR-673 miR-673 Rattus norvegicus
CUCACAGCUCCGGUCCUUGGAG
975 picture button
rno-miR-674-3p miR-674 Rattus norvegicus
CACAGCUCCCAUCUCAGAACAA
834 picture button
rno-miR-674-5p miR-674 Rattus norvegicus
GCACUGAGAUGGGAGUGGUGUA
916 picture button
mmu-miR-675-3p miR-675 Mus musculus
CUGUAUGCCCUAACCGCUCAGU
803 picture button
mmu-miR-675-5p miR-675 Mus musculus
UGGUGCGGAAAGGGCCCACAGU
965 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
750 picture button
mmu-miR-677 miR-677 Mus musculus
UUCAGUGAUGAUUAGCUUCUGA
911 picture button
mmu-miR-678 miR-678 Mus musculus
GUCUCGGUGCAAGGACUGGAGG
833 picture button
mmu-miR-679 miR-679 Mus musculus
GGACUGUGAGGUGACUCUUGGU
889 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
874 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
834 picture button
mmu-miR-682 miR-682 Mus musculus
CUGCAGUCACAGUGAAGUCUG
936 picture button
mmu-miR-683 miR-683 Mus musculus
CCUGCUGUAAGCUGUGUCCUC
862 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
684 picture button
mmu-miR-685 miR-685 Mus musculus
UCAAUGGCUGAGGUGAGGCAC
945 picture button
mmu-miR-686 miR-686 Mus musculus
AUUGCUUCCCAGACGGUGAAGA
717 picture button
mmu-miR-687 miR-687 Mus musculus
CUAUCCUGGAAUGCAGCAAUGA
879 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
722 picture button
mmu-miR-689 miR-689 Mus musculus
CGUCCCCGCUCGGCGGGGUCC
729 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
805 picture button
mmu-miR-691 miR-691 Mus musculus
AUUCCUGAAGAGAGGCAGAAAA
865 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
553 picture button
mmu-miR-693-3p miR-693 Mus musculus
GCAGCUUUCAGAUGUGGCUGUAA
913 picture button
mmu-miR-693-5p miR-693 Mus musculus
CAGCCACAUCCGAAAGUUUUC
1058 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
636 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
798 picture button
mmu-miR-696 miR-696 Mus musculus
GCGUGUGCUUGCUGUGGG
803 picture button

Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer