spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1243 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1199 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1234 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
1085 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
1252 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1222 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1214 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1206 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1224 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
798 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
841 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
870 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
998 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
874 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
995 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
900 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
818 picture button
rno-miR-532-3p miR-532 Rattus norvegicus
CCUCCCACACCCAAGGCUUGCA
896 picture button
rno-miR-532-5p miR-532 Rattus norvegicus
CAUGCCUUGAGUGUAGGACUGU
955 picture button
rno-miR-539 miR-539 Rattus norvegicus
GGAGAAAUUAUCCUUGGUGUGU
618 picture button
rno-miR-540 miR-540 Rattus norvegicus
AGGUCAGAGGUCGAUCCUGG
1020 picture button
rno-miR-541 miR-541 Rattus norvegicus
AAGGGAUUCUGAUGUUGGUCACACU
714 picture button
rno-miR-542-3p miR-542 Rattus norvegicus
UGUGACAGAUUGAUAACUGAAA
929 picture button
rno-miR-542-5p miR-542 Rattus norvegicus
CUCGGGGAUCAUCAUGUCACGA
922 picture button
rno-miR-543* miR-543* Rattus norvegicus
AAACAUUCGCGGUGCACUUCU
770 picture button
rno-miR-543 miR-543 Rattus norvegicus
AAGUUGCCCGCGUGUUUUUCGC
809 picture button
mmu-miR-544 miR-544 Mus musculus
AUUCUGCAUUUUUAGCAAGCUC
790 picture button
bta-miR-545 miR-545 Bos taurus
AUCAACAAACAUUUAUUGUGUG
945 picture button
mmu-miR-546 miR-546 Mus musculus
AUGGUGGCACGGAGUC
941 picture button
mmu-miR-547 miR-547 Mus musculus
CUUGGUACAUCUUUGAGUGAG
878 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
1149 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
1050 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
1170 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
1046 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
1231 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
1025 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
1244 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
1044 picture button
hsa-miR-549 miR-549 Homo sapiens
UGACAACUAUGGAUGAGCUCU
962 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
916 picture button
mmu-miR-551b miR-551 Mus musculus
GCGACCCAUACUUGGUUUCAG
835 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
721 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
890 picture button
hsa-miR-554 miR-554 Homo sapiens
GCUAGUCCUGACUCAGCCAGU
927 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
739 picture button
hsa-miR-556-5p miR-556 Homo sapiens
GAUGAGCUCAUUGUAAUAUGAG
984 picture button
hsa-miR-556-3p miR-556 Homo sapiens
AUAUUACCAUUAGCUCAUCUUU
1043 picture button
hsa-miR-557 miR-557 Homo sapiens
GUUUGCACGGGUGGGCCUUGUCU
898 picture button
hsa-miR-558 miR-558 Homo sapiens
UGAGCUGCUGUACCAAAAU
957 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
596 picture button
hsa-miR-560 miR-560 Homo sapiens
GCGUGCGCCGGCCGGCCGCC
934 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
736 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
896 picture button
hsa-miR-563 miR-563 Homo sapiens
AGGUUGACAUACGUUUCCC
894 picture button
hsa-miR-564 miR-564 Homo sapiens
AGGCACGGUGUCAGCAGGC
789 picture button
hsa-miR-565 miR-565 Homo sapiens
GGCUGGCUCGCGAUGUCUGUUU
782 picture button
hsa-miR-566 miR-566 Homo sapiens
GGGCGCCUGUGAUCCCAAC
926 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
748 picture button
mmu-miR-568 miR-568 Mus musculus
AUGUAUAAAUGUAUACACAC
796 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
764 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
588 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
743 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
923 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
746 picture button
mmu-miR-574-5p miR-574 Mus musculus
UGAGUGUGUGUGUGUGAGUGUGU
979 picture button
mmu-miR-574-3p miR-574 Mus musculus
CACGCUCAUGCACACACCCACA
1110 picture button
hsa-miR-575 miR-575 Homo sapiens
GAGCCAGUUGGACAGGAGC
969 picture button
hsa-miR-576-5p miR-576 Homo sapiens
AUUCUAAUUUCUCCACGUCUUU
897 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
810 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
534 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
700 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
705 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
690 picture button
hsa-miR-581 miR-581 Homo sapiens
UCUUGUGUUCUCUAGAUCAGU
776 picture button
mmu-miR-582-5p miR-582 Mus musculus
UACAGUUGUUCAACCAGUUACU
955 picture button
mmu-miR-582-3p miR-582 Mus musculus
CCUGUUGAACAACUGAACCCAA
906 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
719 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
763 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
727 picture button
hsa-miR-586 miR-586 Homo sapiens
UAUGCAUUGUAUUUUUAGGUCC
875 picture button
hsa-miR-587 miR-587 Homo sapiens
UUUCCAUAGGUGAUGAGUCAC
933 picture button
hsa-miR-588 miR-588 Homo sapiens
UUGGCCACAAUGGGUUAGAAC
999 picture button
hsa-miR-589 miR-589 Homo sapiens
UGAGAACCACGUCUGCUCUGAG
931 picture button
mmu-miR-590-5p miR-590 Mus musculus
GAGCUUAUUCAUAAAAGUGCAG
1014 picture button
mmu-miR-590-3p miR-590 Mus musculus
UAAUUUUAUGUAUAAGCUAGU
892 picture button
hsa-miR-591 miR-591 Homo sapiens
AGACCAUGGGUUCUCAUUGU
915 picture button
mmu-miR-592 miR-592 Mus musculus
AUUGUGUCAAUAUGCGAUGAUGU
780 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
627 picture button
hsa-miR-595 miR-595 Homo sapiens
GAAGUGUGCCGUGGUGUGUCU
886 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
949 picture button
hsa-miR-597 miR-597 Homo sapiens
UGUGUCACUCGAUGACCACUGU
861 picture button
rno-miR-598-5p miR-598 Rattus norvegicus
GCGGUGAUGCCGAUGGUGCGAG
839 picture button
rno-miR-598-3p miR-598 Rattus norvegicus
UACGUCAUCGUCGUCAUCGUUA
981 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
774 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
761 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
819 picture button
hsa-miR-602 miR-602 Homo sapiens
GACACGGGCGACAGCUGCGGCCC
726 picture button
hsa-miR-603 miR-603 Homo sapiens
CACACACUGCAAUUACUUUUGC
930 picture button
hsa-miR-604 miR-604 Homo sapiens
AGGCUGCGGAAUUCAGGAC
806 picture button
hsa-miR-605 miR-605 Homo sapiens
UAAAUCCCAUGGUGCCUUCUCCU
1049 picture button

Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer