spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
rno-miR-409-5p miR-409 Rattus norvegicus
AGGUUACCCGAGCAACUUUG
1014 picture button
rno-miR-410 miR-410 Rattus norvegicus
AAUAUAACACAGAUGGCCUGU
865 picture button
rno-miR-411 miR-411 Rattus norvegicus
UAGUAGACCGUAUAGCGUACG
875 picture button
rno-miR-412 miR-412 Rattus norvegicus
ACUUCACCUGGUCCACUAGCCGU
845 picture button
rno-miR-421 miR-421 Rattus norvegicus
GGCCUCAUUAAAUGUUUGUUG
831 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
822 picture button
rno-miR-423 miR-423 Rattus norvegicus
AGCUCGGUCUGAGGCCCCUCAGU
808 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
964 picture button
rno-miR-425 miR-425 Rattus norvegicus
AAUGACACGAUCACUCCCGUUGA
976 picture button
rno-miR-429 miR-429 Rattus norvegicus
UAAUACUGUCUGGUAAUGCCGU
1057 picture button
rno-miR-431 miR-431 Rattus norvegicus
UGUCUUGCAGGCCGUCAUGCA
851 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
857 picture button
rno-miR-433 miR-433 Rattus norvegicus
AUCAUGAUGGGCUCCUCGGUGU
780 picture button
rno-miR-434 miR-434 Rattus norvegicus
UUUGAACCAUCACUCGACUCCU
1023 picture button
rno-miR-448 miR-448 Rattus norvegicus
UUGCAUAUGUAGGAUGUCCCAU
823 picture button
rno-miR-449a miR-449 Rattus norvegicus
UGGCAGUGUAUUGUUAGCUGGU
959 picture button
rno-miR-450a miR-450 Rattus norvegicus
UUUUUGCGAUGUGUUCCUAAUG
790 picture button
rno-miR-451 miR-451 Rattus norvegicus
AAACCGUUACCAUUACUGAGUU
856 picture button
mmu-miR-452 miR-452 Mus musculus
UGUUUGCAGAGGAAACUGAGAC
852 picture button
mmu-miR-453 miR-453 Mus musculus
AGGUUGCCUCAUAGUGAGCUUGCA
853 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
950 picture button
rno-miR-455 miR-455 Rattus norvegicus
UAUGUGCCUUUGGACUACAUCG
872 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
822 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
886 picture button
rno-miR-463 miR-463 Rattus norvegicus
UGAUAGACGCCAAUUUGGGUAG
818 picture button
mmu-miR-464 miR-464 Mus musculus
UACCAAGUUUAUUCUGUGAGAUA
940 picture button
mmu-miR-465b-5p miR-465 Mus musculus
UAUUUAGAAUGGUGCUGAUCUG
922 picture button
mmu-miR-465a-5p miR-465 Mus musculus
UAUUUAGAAUGGCACUGAUGUGA
921 picture button
mmu-miR-465c-5p miR-465 Mus musculus
UAUUUAGAAUGGCGCUGAUCUG
909 picture button
mmu-miR-465a-3p miR-465 Mus musculus
GAUCAGGGCCUUUCUAAGUAGA
922 picture button
rno-miR-466c miR-466 Rattus norvegicus
UGUGAUGUGUGCAUGUACAUG
1002 picture button
rno-miR-466b miR-466 Rattus norvegicus
UAUGUGUGUGUGUAUGUCCAUG
1109 picture button
mmu-miR-467e miR-467 Mus musculus
AUAAGUGUGAGCAUGUAUAUGU
954 picture button
mmu-miR-467b miR-467 Mus musculus
GUAAGUGCCUGCAUGUAUAUG
1036 picture button
mmu-miR-467d miR-467 Mus musculus
UAAGUGCGCGCAUGUAUAUGCG
1033 picture button
mmu-miR-467a miR-467 Mus musculus
UAAGUGCCUGCAUGUAUAUGCG
1156 picture button
mmu-miR-467c miR-467 Mus musculus
UAAGUGCGUGCAUGUAUAUGUG
1072 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
896 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
832 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
764 picture button
rno-miR-471 miR-471 Rattus norvegicus
UACGUAGUAUAGUGCUUUUCAC
834 picture button
rno-miR-483 miR-483 Rattus norvegicus
UCACUCCUCCCCUCCCGUCUUGU
951 picture button
rno-miR-484 miR-484 Rattus norvegicus
UCAGGCUCAGUCCCCUCCCGAU
907 picture button
rno-miR-485 miR-485 Rattus norvegicus
AGAGGCUGGCCGUGAUGAAUUC
830 picture button
mmu-miR-486 miR-486 Mus musculus
UCCUGUACUGAGCUGCCCCGAG
985 picture button
rno-miR-487b miR-487 Rattus norvegicus
AAUCGUACAGGGUCAUCCACU
865 picture button
rno-miR-488 miR-488 Rattus norvegicus
UUGAAAGGCUGUUUCUUGGUC
796 picture button
rno-miR-489 miR-489 Rattus norvegicus
AAUGACAUCACAUAUAUGGCAGC
876 picture button
mmu-miR-490 miR-490 Mus musculus
CAACCUGGAGGACUCCAUGCUG
950 picture button
mmu-miR-491 miR-491 Mus musculus
AGUGGGGAACCCUUCCAUGAGG
845 picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
886 picture button
rno-miR-493 miR-493 Rattus norvegicus
UGAAGGUCUACUGUGUGCCAG
887 picture button
rno-miR-494 miR-494 Rattus norvegicus
UGAAACAUACACGGGAAACCU
701 picture button
rno-miR-495 miR-495 Rattus norvegicus
AAACAAACAUGGUGCACUUCUU
932 picture button
mmu-miR-496 miR-496 Mus musculus
UGAGUAUUACAUGGCCAAUCUC
677 picture button
rno-miR-497 miR-497 Rattus norvegicus
CAGCAGCACACUGUGGUUUGUA
950 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
935 picture button
rno-miR-499 miR-499 Rattus norvegicus
UUAAGACUUGCAGUGAUGUUU
883 picture button
rno-miR-500 miR-500 Rattus norvegicus
AAUGCACCUGGGCAAGGGUUCA
901 picture button
rno-miR-501 miR-501 Rattus norvegicus
AAUCCUUUGUCCCUGGGUGAAA
708 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
1041 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
994 picture button
rno-miR-503 miR-503 Rattus norvegicus
UAGCAGCGGGAACAGUACUGCAG
914 picture button
mmu-miR-504 miR-504 Mus musculus
AGACCCUGGUCUGCACUCUAUC
913 picture button
rno-miR-505 miR-505 Rattus norvegicus
GUCAACACUUGCUGGUUUCC
1024 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
962 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
908 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
821 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
867 picture button
mmu-miR-509-5p miR-509 Mus musculus
UACUCCAGAAUGUGGCAAUCAU
872 picture button
mmu-miR-509-3p miR-509 Mus musculus
UGAUUGACAUUUCUGUAAUGG
1001 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
805 picture button
mmu-miR-511 miR-511 Mus musculus
AUGCCUUUUGCUCUGCACUCA
629 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
921 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
943 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
849 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
893 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
900 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
1047 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
1076 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
935 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
871 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
923 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
829 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
957 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
948 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
1167 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1339 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
1137 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
1091 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
1162 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
1034 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
1176 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
1203 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1137 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1109 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1112 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
1179 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1129 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
1065 picture button

Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer