spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-220 miR-220 Mus musculus
CCACCACAGUGUCAGACACUU
1057 picture button
rno-miR-221 miR-221 Rattus norvegicus
AGCUACAUUGUCUGCUGGGUUUC
916 picture button
rno-miR-222 miR-222 Rattus norvegicus
AGCUACAUCUGGCUACUGGGU
948 picture button
rno-miR-223 miR-223 Rattus norvegicus
UGUCAGUUUGUCAAAUACCCC
772 picture button
rno-miR-224 miR-224 Rattus norvegicus
CAAGUCACUAGUGGUUCCGUUUA
951 picture button
rno-miR-290 miR-290 Rattus norvegicus
CUCAAACUAUGGGGGCACUUUUU
1007 picture button
rno-miR-291a-3p miR-291 Rattus norvegicus
AAAGUGCUUCCACUUUGUGUGCC
1028 picture button
rno-miR-291a-5p miR-291 Rattus norvegicus
CAUCAAAGUGGAGGCCCUCUCU
957 picture button
rno-miR-292-5p miR-292 Rattus norvegicus
ACUCAAACUGGGGGCUCUUUUG
1038 picture button
rno-miR-292-3p miR-292 Rattus norvegicus
AAGUGCCGCCAGGUUUUGAGUGU
848 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
937 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
878 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
957 picture button
rno-miR-296* miR-296* Rattus norvegicus
AGGGCCCCCCCUCAAUCCUGU
514 picture button
rno-miR-296 miR-296 Rattus norvegicus
GAGGGUUGGGUGGAGGCUCUCC
882 picture button
rno-miR-297 miR-297 Rattus norvegicus
AUGUAUGUGUGCAUGUAUGCAUG
899 picture button
rno-miR-298 miR-298 Rattus norvegicus
GGCAGAGGAGGGCUGUUCUUCCC
854 picture button
rno-miR-299 miR-299 Rattus norvegicus
UGGUUUACCGUCCCACAUACAU
885 picture button
rno-miR-300-3p miR-300 Rattus norvegicus
UAUGCAAGGGCAAGCUCUCUUC
935 picture button
rno-miR-300-5p miR-300 Rattus norvegicus
UUGAAGAGAGGUUAUCCUUUGU
723 picture button
rno-miR-301a miR-301 Rattus norvegicus
CAGUGCAAUAGUAUUGUCAAAGC
983 picture button
rno-miR-301b miR-301 Rattus norvegicus
CAGUGCAAUGGUAUUGUCAAAGC
929 picture button
mmu-miR-302b miR-302 Mus musculus
UAAGUGCUUCCAUGUUUUAGUAG
977 picture button
mmu-miR-302d miR-302 Mus musculus
UAAGUGCUUCCAUGUUUGAGUGU
1043 picture button
mmu-miR-302a miR-302 Mus musculus
UAAGUGCUUCCAUGUUUUGGUGA
1031 picture button
mmu-miR-302c miR-302 Mus musculus
AAGUGCUUCCAUGUUUCAGUGG
941 picture button
rno-miR-320 miR-320 Rattus norvegicus
AAAAGCUGGGUUGAGAGGGCGA
915 picture button
rno-miR-322* miR-322* Rattus norvegicus
AAACAUGAAGCGCUGCAACA
784 picture button
rno-miR-322 miR-322 Rattus norvegicus
CAGCAGCAAUUCAUGUUUUGGA
953 picture button
rno-miR-323 miR-323 Rattus norvegicus
CACAUUACACGGUCGACCUCU
1020 picture button
rno-miR-323* miR-323* Rattus norvegicus
AGGUGGUCCGUGGCGCGUUCGC
708 picture button
rno-miR-324-5p miR-324 Rattus norvegicus
CGCAUCCCCUAGGGCAUUGGUGU
983 picture button
rno-miR-324-3p miR-324 Rattus norvegicus
CCACUGCCCCAGGUGCUGCUGG
1129 picture button
rno-miR-325-5p miR-325 Rattus norvegicus
CCUAGUAGGUGCUCAGUAAGUGU
841 picture button
rno-miR-325-3p miR-325 Rattus norvegicus
UUUAUUGAGCACCUCCUAUCAA
1022 picture button
rno-miR-326 miR-326 Rattus norvegicus
CCUCUGGGCCCUUCCUCCAGU
718 picture button
rno-miR-327 miR-327 Rattus norvegicus
CCUUGAGGGGCAUGAGGGU
816 picture button
rno-miR-328 miR-328 Rattus norvegicus
CUGGCCCUCUCUGCCCUUCCGU
812 picture button
rno-miR-329 miR-329 Rattus norvegicus
AACACACCCAGCUAACCUUUUU
881 picture button
rno-miR-330 miR-330 Rattus norvegicus
UCUCUGGGCCUGUGUCUUAGGC
731 picture button
rno-miR-330* miR-330* Rattus norvegicus
GCAAAGCACAGGGCCUGCAGAGA
702 picture button
rno-miR-331 miR-331 Rattus norvegicus
GCCCCUGGGCCUAUCCUAGAA
827 picture button
rno-miR-333 miR-333 Rattus norvegicus
GUGGUGUGCUAGUUACUUUU
852 picture button
rno-miR-335 miR-335 Rattus norvegicus
UCAAGAGCAAUAACGAAAAAUGU
896 picture button
rno-miR-336 miR-336 Rattus norvegicus
UCACCCUUCCAUAUCUAGUCU
936 picture button
rno-miR-337 miR-337 Rattus norvegicus
UUCAGCUCCUAUAUGAUGCCUUU
900 picture button
rno-miR-338* miR-338* Rattus norvegicus
AACAAUAUCCUGGUGCUGAGUG
681 picture button
rno-miR-338 miR-338 Rattus norvegicus
UCCAGCAUCAGUGAUUUUGUUGA
1009 picture button
rno-miR-339-5p miR-339 Rattus norvegicus
UCCCUGUCCUCCAGGAGCUCACG
962 picture button
rno-miR-339-3p miR-339 Rattus norvegicus
UGAGCGCCUCGACGACAGAGCCA
933 picture button
rno-miR-340-5p miR-340 Rattus norvegicus
UUAUAAAGCAAUGAGACUGAUU
729 picture button
rno-miR-340-3p miR-340 Rattus norvegicus
UCCGUCUCAGUUACUUUAUAGCC
745 picture button
rno-miR-341 miR-341 Rattus norvegicus
UCGGUCGAUCGGUCGGUCGGU
899 picture button
rno-miR-342-3p miR-342 Rattus norvegicus
UCUCACACAGAAAUCGCACCCGU
1000 picture button
rno-miR-342-5p miR-342 Rattus norvegicus
AGGGGUGCUAUCUGUGAUUGAG
1111 picture button
rno-miR-343 miR-343 Rattus norvegicus
UCUCCCUCCGUGUGCCCAGA
866 picture button
rno-miR-344-3p miR-344 Rattus norvegicus
UGAUCUAGCCAAAGCCUGACCGU
855 picture button
rno-miR-344-5p miR-344 Rattus norvegicus
UCAGGCUCCUGGCUAGAUUCCAGG
807 picture button
rno-miR-345-5p miR-345 Rattus norvegicus
UGCUGACCCCUAGUCCAGUGC
967 picture button
rno-miR-345-3p miR-345 Rattus norvegicus
CCCUGAACUAGGGGUCUGGAGA
873 picture button
rno-miR-346 miR-346 Rattus norvegicus
UGUCUGCCUGAGUGCCUGCCUCU
830 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
812 picture button
rno-miR-349 miR-349 Rattus norvegicus
CAGCCCUGCUGUCUUAACCUCU
862 picture button
rno-miR-350 miR-350 Rattus norvegicus
UUCACAAAGCCCAUACACUUUCAC
887 picture button
rno-miR-351 miR-351 Rattus norvegicus
UCCCUGAGGAGCCCUUUGAGCCUGA
971 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
723 picture button
rno-miR-361 miR-361 Rattus norvegicus
UUAUCAGAAUCUCCAGGGGUAC
897 picture button
mmu-miR-362-3p miR-362 Mus musculus
AACACACCUGUUCAAGGAUUCA
1013 picture button
mmu-miR-362-5p miR-362 Mus musculus
AAUCCUUGGAACCUAGGUGUGAAU
977 picture button
rno-miR-363 miR-363 Rattus norvegicus
AAUUGCACGGUAUCCAUCUGUA
979 picture button
rno-miR-363* miR-363* Rattus norvegicus
CGGGUGGAUCACGAUGCAAUUU
602 picture button
rno-miR-365 miR-365 Rattus norvegicus
UAAUGCCCCUAAAAAUCCUUAU
1056 picture button
mmu-miR-367 miR-367 Mus musculus
AAUUGCACUUUAGCAAUGGUGA
1015 picture button
rno-miR-369-5p miR-369 Rattus norvegicus
AGAUCGACCGUGUUAUAUUCGC
935 picture button
rno-miR-369-3p miR-369 Rattus norvegicus
AAUAAUACAUGGUUGAUCUUU
972 picture button
rno-miR-370 miR-370 Rattus norvegicus
GCCUGCUGGGGUGGAACCUGGUU
900 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
1051 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
981 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
846 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
924 picture button
rno-miR-374 miR-374 Rattus norvegicus
AUAUAAUACAACCUGCUAAGUG
756 picture button
rno-miR-375 miR-375 Rattus norvegicus
UUUGUUCGUUCGGCUCGCGUGA
898 picture button
rno-miR-376b-3p miR-376 Rattus norvegicus
AUCAUAGAGGAACAUCCACUU
1018 picture button
rno-miR-376c miR-376 Rattus norvegicus
AACAUAGAGGAAAUUUCACGU
932 picture button
rno-miR-376a miR-376 Rattus norvegicus
AUCGUAGAGGAAAAUCCACGU
986 picture button
rno-miR-376b-5p miR-376 Rattus norvegicus
GUGGAUAUUCCUUCUAUGGUUA
778 picture button
rno-miR-376a* miR-376* Rattus norvegicus
GGUAGAUUCUCCUUCUAUGAG
686 picture button
rno-miR-377 miR-377 Rattus norvegicus
AUCACACAAAGGCAACUUUUGG
791 picture button
rno-miR-378 miR-378 Rattus norvegicus
ACUGGACUUGGAGUCAGAAGG
880 picture button
rno-miR-378* miR-378* Rattus norvegicus
CUCCUGACUCCAGGUCCUGUGU
822 picture button
rno-miR-379* miR-379* Rattus norvegicus
CUAUGUAACAUGGUCCACUAAC
595 picture button
rno-miR-379 miR-379 Rattus norvegicus
UGGUAGACUAUGGAACGUAGG
847 picture button
rno-miR-380 miR-380 Rattus norvegicus
AUGGUUGACCAUAGAACAUGCG
804 picture button
rno-miR-381 miR-381 Rattus norvegicus
UAUACAAGGGCAAGCUCUC
768 picture button
rno-miR-382* miR-382* Rattus norvegicus
AAUCAUUCACGGACAACACUU
755 picture button
rno-miR-382 miR-382 Rattus norvegicus
GAAGUUGUUCGUGGUGGAUUCG
740 picture button
rno-miR-383 miR-383 Rattus norvegicus
AGAUCAGAAGGUGACUGUGGCU
1003 picture button
rno-miR-384-5p miR-384 Rattus norvegicus
UGUAAACAAUUCCUAGGCAAUGU
822 picture button
rno-miR-384-3p miR-384 Rattus norvegicus
AUUCCUAGAAAUUGUUCACAAU
753 picture button
rno-miR-409-3p miR-409 Rattus norvegicus
AAUGUUGCUCGGUGAACCCC
965 picture button

Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer