spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
rno-miR-296* miR-296* Rattus norvegicus
AGGGCCCCCCCUCAAUCCUGU
514 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
531 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
534 picture button
rno-miR-204* miR-204* Rattus norvegicus
GCUGGGAAGGCAAAGGGACGUU
543 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
553 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
571 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
588 picture button
rno-miR-379* miR-379* Rattus norvegicus
CUAUGUAACAUGGUCCACUAAC
595 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
596 picture button
rno-miR-363* miR-363* Rattus norvegicus
CGGGUGGAUCACGAUGCAAUUU
602 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
613 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
615 picture button
rno-miR-1* miR-1* Rattus norvegicus
GCACAUACUUCUUUAUGUACCC
618 picture button
rno-miR-539 miR-539 Rattus norvegicus
GGAGAAAUUAUCCUUGGUGUGU
618 picture button
rno-miR-151* miR-151* Rattus norvegicus
CUAGACUGAGGCUCCUUGAGG
619 picture button
rno-miR-126* miR-126* Rattus norvegicus
CAUUAUUACUUUUGGUACGCG
625 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
627 picture button
mmu-miR-511 miR-511 Mus musculus
AUGCCUUUUGCUCUGCACUCA
629 picture button
rno-miR-129* miR-129* Rattus norvegicus
AAGCCCUUACCCCAAAAAGCAU
631 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
631 picture button
rno-miR-23a* miR-23* Rattus norvegicus
GGGGUUCCUGGGGAUGGGAUUU
634 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
636 picture button
rno-miR-98 miR-98 Rattus norvegicus
UGAGGUAGUAAGUUGUAUUGUU
646 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
653 picture button
rno-miR-211 miR-211 Rattus norvegicus
UUCCCUUUGUCAUCCUUUGCCU
655 picture button
rno-miR-106b* miR-106* Rattus norvegicus
CCGCACUGUGGGUACUUGCUGC
657 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
658 picture button
rno-miR-135a* miR-135* Rattus norvegicus
UGUAGGGAUGGAAGCCAUGAAA
659 picture button
rno-miR-25* miR-25* Rattus norvegicus
AGGCGGAGACACGGGCAAUUGC
664 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
664 picture button
rno-miR-879 miR-879 Rattus norvegicus
AGAGGCUUAUAGCUCUAAGCC
664 picture button
rno-miR-185 miR-185 Rattus norvegicus
UGGAGAGAAAGGCAGUUCCUGA
671 picture button
rno-miR-193* miR-193* Rattus norvegicus
UGGGUCUUUGCGGGCAAGAUGA
673 picture button
rno-miR-26b* miR-26* Rattus norvegicus
CCUGUUCUCCAUUACUUGGCUC
675 picture button
rno-miR-27a* miR-27* Rattus norvegicus
AGGGCUUAGCUGCUUGUGAGCA
677 picture button
mmu-miR-496 miR-496 Mus musculus
UGAGUAUUACAUGGCCAAUCUC
677 picture button
rno-miR-877 miR-877 Rattus norvegicus
GUAGAGGAGAUGGCGCAGGG
677 picture button
rno-miR-9* miR-9* Rattus norvegicus
AUAAAGCUAGAUAACCGAAAGU
679 picture button
rno-miR-338* miR-338* Rattus norvegicus
AACAAUAUCCUGGUGCUGAGUG
681 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
684 picture button
rno-miR-376a* miR-376* Rattus norvegicus
GGUAGAUUCUCCUUCUAUGAG
686 picture button
rno-miR-872* miR-872* Rattus norvegicus
UGAACUAUUGCAGUAGCCUCCU
688 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
690 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
692 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
692 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
700 picture button
rno-miR-494 miR-494 Rattus norvegicus
UGAAACAUACACGGGAAACCU
701 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
701 picture button
rno-miR-330* miR-330* Rattus norvegicus
GCAAAGCACAGGGCCUGCAGAGA
702 picture button
rno-miR-7a* miR-7* Rattus norvegicus
ACAACAAAUCACAGUCUGCCAU
705 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
705 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
707 picture button
rno-miR-323* miR-323* Rattus norvegicus
AGGUGGUCCGUGGCGCGUUCGC
708 picture button
rno-miR-501 miR-501 Rattus norvegicus
AAUCCUUUGUCCCUGGGUGAAA
708 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
709 picture button
rno-miR-708 miR-708 Rattus norvegicus
AAGGAGCUUACAAUCUAGCUGGG
709 picture button
rno-miR-541 miR-541 Rattus norvegicus
AAGGGAUUCUGAUGUUGGUCACACU
714 picture button
mmu-miR-686 miR-686 Mus musculus
AUUGCUUCCCAGACGGUGAAGA
717 picture button
rno-miR-326 miR-326 Rattus norvegicus
CCUCUGGGCCCUUCCUCCAGU
718 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
719 picture button
rno-miR-22* miR-22* Rattus norvegicus
AGUUCUUCAGUGGCAAGCUUUA
720 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
721 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
721 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
722 picture button
rno-miR-300-5p miR-300 Rattus norvegicus
UUGAAGAGAGGUUAUCCUUUGU
723 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
723 picture button
hsa-miR-602 miR-602 Homo sapiens
GACACGGGCGACAGCUGCGGCCC
726 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
727 picture button
rno-miR-340-5p miR-340 Rattus norvegicus
UUAUAAAGCAAUGAGACUGAUU
729 picture button
mmu-miR-689 miR-689 Mus musculus
CGUCCCCGCUCGGCGGGGUCC
729 picture button
rno-miR-330 miR-330 Rattus norvegicus
UCUCUGGGCCUGUGUCUUAGGC
731 picture button
rno-miR-672 miR-672 Rattus norvegicus
UGAGGUUGGUGUACUGUGUGUGA
732 picture button
rno-miR-28* miR-28* Rattus norvegicus
CACUAGAUUGUGAGCUCCUGGA
735 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
735 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
736 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
736 picture button
rno-miR-881 miR-881 Rattus norvegicus
AACUGUGGCAUUUCUGAAUAGA
736 picture button
rno-miR-101a* miR-101* Rattus norvegicus
UCAGUUAUCACAGUGCUGAUGC
739 picture button
rno-miR-126 miR-126 Rattus norvegicus
UCGUACCGUGAGUAAUAAUGCG
739 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
739 picture button
rno-miR-124* miR-124* Rattus norvegicus
CGUGUUCACAGCGGACCUUGAU
740 picture button
rno-miR-382 miR-382 Rattus norvegicus
GAAGUUGUUCGUGGUGGAUUCG
740 picture button
rno-miR-28 miR-28 Rattus norvegicus
AAGGAGCUCACAGUCUAUUGAG
741 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
742 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
743 picture button
rno-miR-760-3p miR-760 Rattus norvegicus
CGGCUCUGGGUCUGUGGGGA
744 picture button
rno-let-7f let-7 Rattus norvegicus
UGAGGUAGUAGAUUGUAUAGUU
745 picture button
rno-miR-340-3p miR-340 Rattus norvegicus
UCCGUCUCAGUUACUUUAUAGCC
745 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
746 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
747 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
748 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
750 picture button
rno-miR-203 miR-203 Rattus norvegicus
GUGAAAUGUUUAGGACCACUAG
752 picture button
rno-miR-207 miR-207 Rattus norvegicus
GCUUCUCCUGGCUCUCCUCCCUU
752 picture button
rno-miR-384-3p miR-384 Rattus norvegicus
AUUCCUAGAAAUUGUUCACAAU
753 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
754 picture button
rno-miR-382* miR-382* Rattus norvegicus
AAUCAUUCACGGACAACACUU
755 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
755 picture button
rno-miR-374 miR-374 Rattus norvegicus
AUAUAAUACAACCUGCUAAGUG
756 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
756 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer