spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
939 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
890 picture button
rno-miR-320 miR-320 Rattus norvegicus
AAAAGCUGGGUUGAGAGGGCGA
915 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
1044 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
1046 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
1050 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
1025 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
841 picture button
rno-miR-495 miR-495 Rattus norvegicus
AAACAAACAUGGUGCACUUCUU
932 picture button
rno-miR-322* miR-322* Rattus norvegicus
AAACAUGAAGCGCUGCAACA
784 picture button
rno-miR-543* miR-543* Rattus norvegicus
AAACAUUCGCGGUGCACUUCU
770 picture button
rno-miR-451 miR-451 Rattus norvegicus
AAACCGUUACCAUUACUGAGUU
856 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
1017 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
901 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
845 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
766 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1339 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
805 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
896 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1112 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1129 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1137 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
957 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
846 picture button
rno-miR-291a-3p miR-291 Rattus norvegicus
AAAGUGCUUCCACUUUGUGUGCC
1028 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1206 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
878 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1243 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1214 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1222 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1234 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
774 picture button
rno-miR-338* miR-338* Rattus norvegicus
AACAAUAUCCUGGUGCUGAGUG
681 picture button
rno-miR-329 miR-329 Rattus norvegicus
AACACACCCAGCUAACCUUUUU
881 picture button
mmu-miR-362-3p miR-362 Mus musculus
AACACACCUGUUCAAGGAUUCA
1013 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
721 picture button
rno-miR-376c miR-376 Rattus norvegicus
AACAUAGAGGAAAUUUCACGU
932 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
948 picture button
rno-miR-181c miR-181 Rattus norvegicus
AACAUUCAACCUGUCGGUGAGU
1058 picture button
rno-miR-181a miR-181 Rattus norvegicus
AACAUUCAACGCUGUCGGUGAGU
1100 picture button
rno-miR-181b miR-181 Rattus norvegicus
AACAUUCAUUGCUGUCGGUGGGU
1116 picture button
rno-miR-181d miR-181 Rattus norvegicus
AACAUUCAUUGUUGUCGGUGGGU
1095 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
916 picture button
rno-miR-100 miR-100 Rattus norvegicus
AACCCGUAGAUCCGAACUUGUG
915 picture button
rno-miR-99a miR-99 Rattus norvegicus
AACCCGUAGAUCCGAUCUUGUG
888 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
798 picture button
rno-miR-193 miR-193 Rattus norvegicus
AACUGGCCUACAAAGUCCCAGU
958 picture button
rno-miR-881 miR-881 Rattus norvegicus
AACUGUGGCAUUUCUGAAUAGA
736 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
810 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
947 picture button
rno-miR-129* miR-129* Rattus norvegicus
AAGCCCUUACCCCAAAAAGCAU
631 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
949 picture button
rno-miR-22 miR-22 Rattus norvegicus
AAGCUGCCAGUUGAAGAACUGU
1069 picture button
rno-miR-28 miR-28 Rattus norvegicus
AAGGAGCUCACAGUCUAUUGAG
741 picture button
rno-miR-708 miR-708 Rattus norvegicus
AAGGAGCUUACAAUCUAGCUGGG
709 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
701 picture button
rno-miR-541 miR-541 Rattus norvegicus
AAGGGAUUCUGAUGUUGGUCACACU
714 picture button
rno-miR-872 miR-872 Rattus norvegicus
AAGGUUACUUGUUAGUUCAGG
797 picture button
rno-miR-292-3p miR-292 Rattus norvegicus
AAGUGCCGCCAGGUUUUGAGUGU
848 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
981 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1109 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
921 picture button
mmu-miR-302c miR-302 Mus musculus
AAGUGCUUCCAUGUUUCAGUGG
941 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1199 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
931 picture button
rno-miR-543 miR-543 Rattus norvegicus
AAGUUGCCCGCGUGUUUUUCGC
809 picture button
rno-miR-369-3p miR-369 Rattus norvegicus
AAUAAUACAUGGUUGAUCUUU
972 picture button
rno-miR-410 miR-410 Rattus norvegicus
AAUAUAACACAGAUGGCCUGU
865 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
709 picture button
rno-miR-34c* miR-34* Rattus norvegicus
AAUCACUAACCACACAGCCAGG
794 picture button
rno-miR-382* miR-382* Rattus norvegicus
AAUCAUUCACGGACAACACUU
755 picture button
mmu-miR-362-5p miR-362 Mus musculus
AAUCCUUGGAACCUAGGUGUGAAU
977 picture button
rno-miR-501 miR-501 Rattus norvegicus
AAUCCUUUGUCCCUGGGUGAAA
708 picture button
rno-miR-487b miR-487 Rattus norvegicus
AAUCGUACAGGGUCAUCCACU
865 picture button
rno-miR-425 miR-425 Rattus norvegicus
AAUGACACGAUCACUCCCGUUGA
976 picture button
rno-miR-489 miR-489 Rattus norvegicus
AAUGACAUCACAUAUAUGGCAGC
876 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
1041 picture button
rno-miR-500 miR-500 Rattus norvegicus
AAUGCACCUGGGCAAGGGUUCA
901 picture button
rno-miR-652 miR-652 Rattus norvegicus
AAUGGCGCCACUAGGGUUGUG
949 picture button
rno-miR-409-3p miR-409 Rattus norvegicus
AAUGUUGCUCGGUGAACCCC
965 picture button
rno-miR-363 miR-363 Rattus norvegicus
AAUUGCACGGUAUCCAUCUGUA
979 picture button
mmu-miR-367 miR-367 Mus musculus
AAUUGCACUUUAGCAAUGGUGA
1015 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
1252 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1224 picture button
rno-miR-7a* miR-7* Rattus norvegicus
ACAACAAAUCACAGUCUGCCAU
705 picture button
rno-miR-125b* miR-125* Rattus norvegicus
ACAAGUCAGGCUCUUGGGACCU
833 picture button
rno-miR-214 miR-214 Rattus norvegicus
ACAGCAGGCACAGACAGGCAG
956 picture button
rno-miR-125a-3p miR-125 Rattus norvegicus
ACAGGUGAGGUUCUUGGGAGCC
1120 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
768 picture button
rno-miR-199a-3p miR-199 Rattus norvegicus
ACAGUAGUCUGCACAUUGGUUA
971 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
922 picture button
mmu-miR-665 miR-665 Mus musculus
ACCAGGAGGCUGAGGUCCCU
798 picture button
rno-miR-181a* miR-181* Rattus norvegicus
ACCAUCGACCGUUGAUUGUACC
961 picture button
rno-miR-125b-3p miR-125 Rattus norvegicus
ACGGGUUAGGCUCUUGGGAGCU
1012 picture button
rno-miR-292-5p miR-292 Rattus norvegicus
ACUCAAACUGGGGGCUCUUUUG
1038 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
1051 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
815 picture button
rno-miR-136 miR-136 Rattus norvegicus
ACUCCAUUUGUUUUGAUGAUGGA
783 picture button
rno-miR-29a* miR-29* Rattus norvegicus
ACUGAUUUCUUUUGGUGUUCAG
835 picture button
rno-miR-17-3p miR-17 Rattus norvegicus
ACUGCAGUGAAGGCACUUGUGG
935 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer