spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
rno-let-7c let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUGGUU
795 picture button
rno-let-7e let-7 Rattus norvegicus
UGAGGUAGGAGGUUGUAUAGUU
886 picture button
rno-let-7b let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUGUGGUU
844 picture button
rno-let-7i let-7 Rattus norvegicus
UGAGGUAGUAGUUUGUGCUGUU
1141 picture button
rno-let-7d let-7 Rattus norvegicus
AGAGGUAGUAGGUUGCAUAGUU
851 picture button
rno-let-7a let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUAGUU
794 picture button
rno-let-7f let-7 Rattus norvegicus
UGAGGUAGUAGAUUGUAUAGUU
745 picture button
rno-let-7i* let-7* Rattus norvegicus
CUGCGCAAGCUACUGCCUUGCU
981 picture button
rno-let-7b* let-7* Rattus norvegicus
CUAUACAACCUACUGCCUUCCC
956 picture button
rno-let-7e* let-7* Rattus norvegicus
CUAUACGGCCUCCUAGCUUUCC
950 picture button
rno-let-7d* let-7* Rattus norvegicus
CUAUACGACCUGCUGCCUUUCU
1000 picture button
rno-miR-1 miR-1 Rattus norvegicus
UGGAAUGUAAAGAAGUGUGUAU
771 picture button
rno-miR-1* miR-1* Rattus norvegicus
GCACAUACUUCUUUAUGUACCC
618 picture button
rno-miR-10b miR-10 Rattus norvegicus
CCCUGUAGAACCGAAUUUGUGU
866 picture button
rno-miR-10a-5p miR-10 Rattus norvegicus
UACCCUGUAGAUCCGAAUUUGUG
992 picture button
rno-miR-10a-3p miR-10 Rattus norvegicus
CAAAUUCGUAUCUAGGGGAAUA
873 picture button
rno-miR-100 miR-100 Rattus norvegicus
AACCCGUAGAUCCGAACUUGUG
915 picture button
rno-miR-101b miR-101 Rattus norvegicus
UACAGUACUGUGAUAGCUGAA
1021 picture button
rno-miR-101a miR-101 Rattus norvegicus
UACAGUACUGUGAUAACUGAA
1027 picture button
rno-miR-101a* miR-101* Rattus norvegicus
UCAGUUAUCACAGUGCUGAUGC
739 picture button
rno-miR-103 miR-103 Rattus norvegicus
AGCAGCAUUGUACAGGGCUAUGA
929 picture button
mmu-miR-105 miR-105 Mus musculus
CCAAGUGCUCAGAUGCUUGUGGU
961 picture button
rno-miR-106b miR-106 Rattus norvegicus
UAAAGUGCUGACAGUGCAGAU
1037 picture button
rno-miR-106b* miR-106* Rattus norvegicus
CCGCACUGUGGGUACUUGCUGC
657 picture button
rno-miR-107 miR-107 Rattus norvegicus
AGCAGCAUUGUACAGGGCUAUCA
865 picture button
rno-miR-122 miR-122 Rattus norvegicus
UGGAGUGUGACAAUGGUGUUUG
783 picture button
rno-miR-124 miR-124 Rattus norvegicus
UAAGGCACGCGGUGAAUGCC
991 picture button
rno-miR-124* miR-124* Rattus norvegicus
CGUGUUCACAGCGGACCUUGAU
740 picture button
rno-miR-125b-5p miR-125 Rattus norvegicus
UCCCUGAGACCCUAACUUGUGA
1151 picture button
rno-miR-125a-3p miR-125 Rattus norvegicus
ACAGGUGAGGUUCUUGGGAGCC
1120 picture button
rno-miR-125b-3p miR-125 Rattus norvegicus
ACGGGUUAGGCUCUUGGGAGCU
1012 picture button
rno-miR-125a-5p miR-125 Rattus norvegicus
UCCCUGAGACCCUUUAACCUGUGA
1133 picture button
rno-miR-125b* miR-125* Rattus norvegicus
ACAAGUCAGGCUCUUGGGACCU
833 picture button
rno-miR-126 miR-126 Rattus norvegicus
UCGUACCGUGAGUAAUAAUGCG
739 picture button
rno-miR-126* miR-126* Rattus norvegicus
CAUUAUUACUUUUGGUACGCG
625 picture button
rno-miR-127 miR-127 Rattus norvegicus
UCGGAUCCGUCUGAGCUUGGCU
842 picture button
rno-miR-128a miR-128 Rattus norvegicus
UCACAGUGAACCGGUCUCUUU
963 picture button
rno-miR-129 miR-129 Rattus norvegicus
CUUUUUGCGGUCUGGGCUUGC
786 picture button
rno-miR-129* miR-129* Rattus norvegicus
AAGCCCUUACCCCAAAAAGCAU
631 picture button
rno-miR-130a miR-130 Rattus norvegicus
CAGUGCAAUGUUAAAAGGGCAU
982 picture button
rno-miR-130b miR-130 Rattus norvegicus
CAGUGCAAUGAUGAAAGGGCAU
1034 picture button
rno-miR-132 miR-132 Rattus norvegicus
UAACAGUCUACAGCCAUGGUCG
1007 picture button
rno-miR-133a miR-133 Rattus norvegicus
UUUGGUCCCCUUCAACCAGCUG
970 picture button
rno-miR-133b miR-133 Rattus norvegicus
UUUGGUCCCCUUCAACCAGCUA
957 picture button
rno-miR-134 miR-134 Rattus norvegicus
UGUGACUGGUUGACCAGAGGGG
891 picture button
rno-miR-135b miR-135 Rattus norvegicus
UAUGGCUUUUCAUUCCUAUGUGA
781 picture button
rno-miR-135a miR-135 Rattus norvegicus
UAUGGCUUUUUAUUCCUAUGUGA
838 picture button
rno-miR-135a* miR-135* Rattus norvegicus
UGUAGGGAUGGAAGCCAUGAAA
659 picture button
rno-miR-136 miR-136 Rattus norvegicus
ACUCCAUUUGUUUUGAUGAUGGA
783 picture button
rno-miR-136* miR-136* Rattus norvegicus
CAUCAUCGUCUCAAAUGAGUCU
768 picture button
rno-miR-137 miR-137 Rattus norvegicus
UUAUUGCUUAAGAAUACGCGUAG
901 picture button
rno-miR-138 miR-138 Rattus norvegicus
AGCUGGUGUUGUGAAUCAGGCCG
871 picture button
rno-miR-138* miR-138* Rattus norvegicus
CGGCUACUUCACAACACCAGGG
1018 picture button
rno-miR-139-5p miR-139 Rattus norvegicus
UCUACAGUGCACGUGUCUCCAG
1003 picture button
rno-miR-139-3p miR-139 Rattus norvegicus
UGGAGACGCGGCCCUGUUGGAG
891 picture button
rno-miR-140 miR-140 Rattus norvegicus
CAGUGGUUUUACCCUAUGGUAG
856 picture button
rno-miR-140* miR-140* Rattus norvegicus
UACCACAGGGUAGAACCACGG
761 picture button
rno-miR-141 miR-141 Rattus norvegicus
UAACACUGUCUGGUAAAGAUGG
1047 picture button
rno-miR-142-3p miR-142 Rattus norvegicus
UGUAGUGUUUCCUACUUUAUGGA
842 picture button
rno-miR-142-5p miR-142 Rattus norvegicus
CAUAAAGUAGAAAGCACUACU
773 picture button
rno-miR-143 miR-143 Rattus norvegicus
UGAGAUGAAGCACUGUAGCUCA
819 picture button
rno-miR-144 miR-144 Rattus norvegicus
UACAGUAUAGAUGAUGUACU
973 picture button
rno-miR-145 miR-145 Rattus norvegicus
GUCCAGUUUUCCCAGGAAUCCCU
797 picture button
rno-miR-146a miR-146 Rattus norvegicus
UGAGAACUGAAUUCCAUGGGUU
909 picture button
rno-miR-147 miR-147 Rattus norvegicus
GUGUGCGGAAAUGCUUCUGCUA
904 picture button
rno-miR-148b-5p miR-148 Rattus norvegicus
GAAGUUCUGUUAUACACUCAGG
901 picture button
rno-miR-148b-3p miR-148 Rattus norvegicus
UCAGUGCAUCACAGAACUUUGU
1072 picture button
mmu-miR-149 miR-149 Mus musculus
UCUGGCUCCGUGUCUUCACUCCC
850 picture button
rno-miR-15b miR-15 Rattus norvegicus
UAGCAGCACAUCAUGGUUUACA
1041 picture button
rno-miR-150 miR-150 Rattus norvegicus
UCUCCCAACCCUUGUACCAGUG
961 picture button
rno-miR-151 miR-151 Rattus norvegicus
UCGAGGAGCUCACAGUCUAGU
804 picture button
rno-miR-151* miR-151* Rattus norvegicus
CUAGACUGAGGCUCCUUGAGG
619 picture button
rno-miR-152 miR-152 Rattus norvegicus
UCAGUGCAUGACAGAACUUGG
1044 picture button
rno-miR-153 miR-153 Rattus norvegicus
UUGCAUAGUCACAAAAGUGAUC
890 picture button
rno-miR-154 miR-154 Rattus norvegicus
UAGGUUAUCCGUGUUGCCUUCG
965 picture button
mmu-miR-155 miR-155 Mus musculus
UUAAUGCUAAUUGUGAUAGGGGU
844 picture button
rno-miR-16 miR-16 Rattus norvegicus
UAGCAGCACGUAAAUAUUGGCG
957 picture button
rno-miR-17-3p miR-17 Rattus norvegicus
ACUGCAGUGAAGGCACUUGUGG
935 picture button
rno-miR-17 miR-17 Rattus norvegicus
CAAAGUGCUUACAGUGCAGGUAG
1113 picture button
rno-miR-18a miR-18 Rattus norvegicus
UAAGGUGCAUCUAGUGCAGAUAG
962 picture button
rno-miR-181c miR-181 Rattus norvegicus
AACAUUCAACCUGUCGGUGAGU
1058 picture button
rno-miR-181b miR-181 Rattus norvegicus
AACAUUCAUUGCUGUCGGUGGGU
1116 picture button
rno-miR-181d miR-181 Rattus norvegicus
AACAUUCAUUGUUGUCGGUGGGU
1095 picture button
rno-miR-181a miR-181 Rattus norvegicus
AACAUUCAACGCUGUCGGUGAGU
1100 picture button
rno-miR-181a* miR-181* Rattus norvegicus
ACCAUCGACCGUUGAUUGUACC
961 picture button
rno-miR-182 miR-182 Rattus norvegicus
UUUGGCAAUGGUAGAACUCACACCG
992 picture button
rno-miR-183 miR-183 Rattus norvegicus
UAUGGCACUGGUAGAAUUCACU
1036 picture button
rno-miR-184 miR-184 Rattus norvegicus
UGGACGGAGAACUGAUAAGGGU
853 picture button
rno-miR-185 miR-185 Rattus norvegicus
UGGAGAGAAAGGCAGUUCCUGA
671 picture button
rno-miR-186 miR-186 Rattus norvegicus
CAAAGAAUUCUCCUUUUGGGCU
759 picture button
rno-miR-187 miR-187 Rattus norvegicus
UCGUGUCUUGUGUUGCAGCCGG
854 picture button
rno-miR-188 miR-188 Rattus norvegicus
CAUCCCUUGCAUGGUGGAGGG
917 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
942 picture button
rno-miR-19b miR-19 Rattus norvegicus
UGUGCAAAUCCAUGCAAAACUGA
987 picture button
rno-miR-19a miR-19 Rattus norvegicus
UGUGCAAAUCUAUGCAAAACUGA
969 picture button
rno-miR-190 miR-190 Rattus norvegicus
UGAUAUGUUUGAUAUAUUAGGU
800 picture button
rno-miR-190b miR-190 Rattus norvegicus
UGAUAUGUUUGAUAUUAGGUU
797 picture button
rno-miR-191 miR-191 Rattus norvegicus
CAACGGAAUCCCAAAAGCAGCUG
876 picture button
rno-miR-192 miR-192 Rattus norvegicus
CUGACCUAUGAAUUGACAGCC
948 picture button
rno-miR-193 miR-193 Rattus norvegicus
AACUGGCCUACAAAGUCCCAGU
958 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer