spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-miR-545 miR-545 Bos taurus
AUCAACAAACAUUUAUUGUGUG
945 picture button
bta-miR-660 miR-660 Bos taurus
UACCCAUUGCAUAUCGGAGCUG
930 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
822 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
886 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
905 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
877 picture button
hsa-miR-198 miR-198 Homo sapiens
GGUCCAGAGGGGAGAUAGGUUC
964 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
981 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
1051 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
846 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
924 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
822 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
964 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
857 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
950 picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
886 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
935 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
994 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
1041 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
962 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
908 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
867 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
821 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
805 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
943 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
921 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
893 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
849 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
900 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
1047 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
1076 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
871 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
923 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
935 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
957 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
948 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
829 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
1034 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
1176 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
1203 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
1167 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1339 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
1091 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
1137 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
1162 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1109 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1112 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
1179 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1129 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1137 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1199 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1234 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
1085 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
1252 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1222 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1214 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1206 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1224 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
1065 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1243 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
798 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
841 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
870 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
874 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
998 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
995 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
900 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
818 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
1170 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
1046 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
1231 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
1025 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
1244 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
1044 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
1149 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
1050 picture button
hsa-miR-549 miR-549 Homo sapiens
UGACAACUAUGGAUGAGCUCU
962 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
916 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
721 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
890 picture button
hsa-miR-554 miR-554 Homo sapiens
GCUAGUCCUGACUCAGCCAGU
927 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
739 picture button
hsa-miR-556-5p miR-556 Homo sapiens
GAUGAGCUCAUUGUAAUAUGAG
984 picture button
hsa-miR-556-3p miR-556 Homo sapiens
AUAUUACCAUUAGCUCAUCUUU
1043 picture button
hsa-miR-557 miR-557 Homo sapiens
GUUUGCACGGGUGGGCCUUGUCU
898 picture button
hsa-miR-558 miR-558 Homo sapiens
UGAGCUGCUGUACCAAAAU
957 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
596 picture button
hsa-miR-560 miR-560 Homo sapiens
GCGUGCGCCGGCCGGCCGCC
934 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
736 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
896 picture button
hsa-miR-563 miR-563 Homo sapiens
AGGUUGACAUACGUUUCCC
894 picture button
hsa-miR-564 miR-564 Homo sapiens
AGGCACGGUGUCAGCAGGC
789 picture button
hsa-miR-565 miR-565 Homo sapiens
GGCUGGCUCGCGAUGUCUGUUU
782 picture button
hsa-miR-566 miR-566 Homo sapiens
GGGCGCCUGUGAUCCCAAC
926 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
748 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
764 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
588 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
743 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
923 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
746 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer