spacer

MicroRNA Listing for Rattus norvegicus


698 microRNAs (348 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
rno-let-7b* let-7* Rattus norvegicus
CUAUACAACCUACUGCCUUCCC
956 picture button
rno-let-7e let-7 Rattus norvegicus
UGAGGUAGGAGGUUGUAUAGUU
886 picture button
rno-let-7b let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUGUGGUU
844 picture button
rno-let-7e* let-7* Rattus norvegicus
CUAUACGGCCUCCUAGCUUUCC
950 picture button
rno-let-7i let-7 Rattus norvegicus
UGAGGUAGUAGUUUGUGCUGUU
1141 picture button
rno-let-7d let-7 Rattus norvegicus
AGAGGUAGUAGGUUGCAUAGUU
851 picture button
rno-let-7a let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUAGUU
794 picture button
rno-let-7d* let-7* Rattus norvegicus
CUAUACGACCUGCUGCCUUUCU
1000 picture button
rno-let-7f let-7 Rattus norvegicus
UGAGGUAGUAGAUUGUAUAGUU
745 picture button
rno-let-7c let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUGGUU
795 picture button
rno-let-7i* let-7* Rattus norvegicus
CUGCGCAAGCUACUGCCUUGCU
981 picture button
rno-miR-1* miR-1* Rattus norvegicus
GCACAUACUUCUUUAUGUACCC
618 picture button
rno-miR-1 miR-1 Rattus norvegicus
UGGAAUGUAAAGAAGUGUGUAU
771 picture button
rno-miR-7a* miR-7* Rattus norvegicus
ACAACAAAUCACAGUCUGCCAU
705 picture button
rno-miR-7b miR-7 Rattus norvegicus
UGGAAGACUUGUGAUUUUGUUGU
924 picture button
rno-miR-7a miR-7 Rattus norvegicus
UGGAAGACUAGUGAUUUUGUUGU
909 picture button
rno-miR-9* miR-9* Rattus norvegicus
AUAAAGCUAGAUAACCGAAAGU
679 picture button
rno-miR-9 miR-9 Rattus norvegicus
UCUUUGGUUAUCUAGCUGUAUGA
872 picture button
rno-miR-10b miR-10 Rattus norvegicus
CCCUGUAGAACCGAAUUUGUGU
866 picture button
rno-miR-10a-5p miR-10 Rattus norvegicus
UACCCUGUAGAUCCGAAUUUGUG
992 picture button
rno-miR-10a-3p miR-10 Rattus norvegicus
CAAAUUCGUAUCUAGGGGAAUA
873 picture button
rno-miR-15b miR-15 Rattus norvegicus
UAGCAGCACAUCAUGGUUUACA
1041 picture button
rno-miR-16 miR-16 Rattus norvegicus
UAGCAGCACGUAAAUAUUGGCG
957 picture button
rno-miR-17-3p miR-17 Rattus norvegicus
ACUGCAGUGAAGGCACUUGUGG
935 picture button
rno-miR-17 miR-17 Rattus norvegicus
CAAAGUGCUUACAGUGCAGGUAG
1113 picture button
rno-miR-18a miR-18 Rattus norvegicus
UAAGGUGCAUCUAGUGCAGAUAG
962 picture button
rno-miR-19b miR-19 Rattus norvegicus
UGUGCAAAUCCAUGCAAAACUGA
987 picture button
rno-miR-19a miR-19 Rattus norvegicus
UGUGCAAAUCUAUGCAAAACUGA
969 picture button
rno-miR-20a miR-20 Rattus norvegicus
UAAAGUGCUUAUAGUGCAGGUAG
1090 picture button
rno-miR-20b-5p miR-20 Rattus norvegicus
CAAAGUGCUCAUAGUGCAGGU
1057 picture button
rno-miR-20b-3p miR-20 Rattus norvegicus
ACUGCAGUGUGAGCACUUCUGG
920 picture button
rno-miR-20a* miR-20* Rattus norvegicus
ACUGCAUUACGAGCACUUACA
775 picture button
rno-miR-21* miR-21* Rattus norvegicus
CAACAGCAGUCGAUGGGCUGUC
792 picture button
rno-miR-21 miR-21 Rattus norvegicus
UAGCUUAUCAGACUGAUGUUGA
906 picture button
rno-miR-22* miR-22* Rattus norvegicus
AGUUCUUCAGUGGCAAGCUUUA
720 picture button
rno-miR-22 miR-22 Rattus norvegicus
AAGCUGCCAGUUGAAGAACUGU
1069 picture button
rno-miR-23a* miR-23* Rattus norvegicus
GGGGUUCCUGGGGAUGGGAUUU
634 picture button
rno-miR-23b miR-23 Rattus norvegicus
AUCACAUUGCCAGGGAUUACC
955 picture button
rno-miR-23a miR-23 Rattus norvegicus
AUCACAUUGCCAGGGAUUUCC
996 picture button
rno-miR-24-1* miR-24* Rattus norvegicus
GUGCCUACUGAGCUGAUAUCAG
848 picture button
rno-miR-24 miR-24 Rattus norvegicus
UGGCUCAGUUCAGCAGGAACAG
839 picture button
rno-miR-24-2* miR-24* Rattus norvegicus
GUGCCUACUGAGCUGAAACAGU
869 picture button
rno-miR-25* miR-25* Rattus norvegicus
AGGCGGAGACACGGGCAAUUGC
664 picture button
rno-miR-25 miR-25 Rattus norvegicus
CAUUGCACUUGUCUCGGUCUGA
979 picture button
rno-miR-26b* miR-26* Rattus norvegicus
CCUGUUCUCCAUUACUUGGCUC
675 picture button
rno-miR-26b miR-26 Rattus norvegicus
UUCAAGUAAUUCAGGAUAGGU
909 picture button
rno-miR-26a miR-26 Rattus norvegicus
UUCAAGUAAUCCAGGAUAGGCU
972 picture button
rno-miR-27b miR-27 Rattus norvegicus
UUCACAGUGGCUAAGUUCUGC
931 picture button
rno-miR-27a miR-27 Rattus norvegicus
UUCACAGUGGCUAAGUUCCGC
885 picture button
rno-miR-27a* miR-27* Rattus norvegicus
AGGGCUUAGCUGCUUGUGAGCA
677 picture button
rno-miR-28* miR-28* Rattus norvegicus
CACUAGAUUGUGAGCUCCUGGA
735 picture button
rno-miR-28 miR-28 Rattus norvegicus
AAGGAGCUCACAGUCUAUUGAG
741 picture button
rno-miR-29c miR-29 Rattus norvegicus
UAGCACCAUUUGAAAUCGGUUA
1176 picture button
rno-miR-29b-1* miR-29* Rattus norvegicus
UUUCAUAUGGUGGUUUAGAUUU
823 picture button
rno-miR-29b miR-29 Rattus norvegicus
UAGCACCAUUUGAAAUCAGUGUU
1096 picture button
rno-miR-29c* miR-29* Rattus norvegicus
UGACCGAUUUCUCCUGGUGUUC
897 picture button
rno-miR-29a* miR-29* Rattus norvegicus
ACUGAUUUCUUUUGGUGUUCAG
835 picture button
rno-miR-29a miR-29 Rattus norvegicus
UAGCACCAUCUGAAAUCGGUUA
1149 picture button
rno-miR-29b-2* miR-29* Rattus norvegicus
CUGGUUUCACAUGGUGGCUUAG
891 picture button
rno-miR-30e miR-30 Rattus norvegicus
UGUAAACAUCCUUGACUGGAAG
1058 picture button
rno-miR-30e* miR-30* Rattus norvegicus
CUUUCAGUCGGAUGUUUACAGC
784 picture button
rno-miR-30c miR-30 Rattus norvegicus
UGUAAACAUCCUACACUCUCAGC
1096 picture button
rno-miR-30c-1* miR-30* Rattus norvegicus
CUGGGAGAGGGUUGUUUACUCC
825 picture button
rno-miR-30a miR-30 Rattus norvegicus
UGUAAACAUCCUCGACUGGAAG
1069 picture button
rno-miR-30d miR-30 Rattus norvegicus
UGUAAACAUCCCCGACUGGAAG
1071 picture button
rno-miR-30d* miR-30* Rattus norvegicus
CUUUCAGUCAGAUGUUUGCUGC
854 picture button
rno-miR-30b-5p miR-30 Rattus norvegicus
UGUAAACAUCCUACACUCAGCU
1078 picture button
rno-miR-30a* miR-30* Rattus norvegicus
CUUUCAGUCGGAUGUUUGCAGC
823 picture button
rno-miR-30c-2* miR-30* Rattus norvegicus
CUGGGAGAAGGCUGUUUACUCU
827 picture button
rno-miR-30b-3p miR-30 Rattus norvegicus
CUGGGAUGUGGAUGUUUACGUC
942 picture button
rno-miR-31 miR-31 Rattus norvegicus
AGGCAAGAUGCUGGCAUAGCUG
972 picture button
rno-miR-32 miR-32 Rattus norvegicus
UAUUGCACAUUACUAAGUUGCA
983 picture button
rno-miR-33 miR-33 Rattus norvegicus
GUGCAUUGUAGUUGCAUUGCA
977 picture button
rno-miR-34b miR-34 Rattus norvegicus
UAGGCAGUGUAAUUAGCUGAUUG
947 picture button
rno-miR-34c* miR-34* Rattus norvegicus
AAUCACUAACCACACAGCCAGG
794 picture button
rno-miR-34a miR-34 Rattus norvegicus
UGGCAGUGUCUUAGCUGGUUGU
1086 picture button
rno-miR-34c miR-34 Rattus norvegicus
AGGCAGUGUAGUUAGCUGAUUGC
1031 picture button
rno-miR-92b miR-92 Rattus norvegicus
UAUUGCACUCGUCCCGGCCUCC
1013 picture button
rno-miR-92a miR-92 Rattus norvegicus
UAUUGCACUUGUCCCGGCCUG
1034 picture button
rno-miR-93 miR-93 Rattus norvegicus
CAAAGUGCUGUUCGUGCAGGUAG
992 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
877 picture button
rno-miR-96 miR-96 Rattus norvegicus
UUUGGCACUAGCACAUUUUUGCU
961 picture button
rno-miR-98 miR-98 Rattus norvegicus
UGAGGUAGUAAGUUGUAUUGUU
646 picture button
rno-miR-99a miR-99 Rattus norvegicus
AACCCGUAGAUCCGAUCUUGUG
888 picture button
rno-miR-99a* miR-99* Rattus norvegicus
CAAGCUCGUUUCUAUGGGUCUG
784 picture button
rno-miR-99b miR-99 Rattus norvegicus
CACCCGUAGAACCGACCUUGCG
853 picture button
rno-miR-99b* miR-99* Rattus norvegicus
CAAGCUCGUGUCUGUGGGUCCG
803 picture button
rno-miR-100 miR-100 Rattus norvegicus
AACCCGUAGAUCCGAACUUGUG
915 picture button
rno-miR-101a miR-101 Rattus norvegicus
UACAGUACUGUGAUAACUGAA
1027 picture button
rno-miR-101a* miR-101* Rattus norvegicus
UCAGUUAUCACAGUGCUGAUGC
739 picture button
rno-miR-101b miR-101 Rattus norvegicus
UACAGUACUGUGAUAGCUGAA
1021 picture button
rno-miR-103 miR-103 Rattus norvegicus
AGCAGCAUUGUACAGGGCUAUGA
929 picture button
mmu-miR-105 miR-105 Mus musculus
CCAAGUGCUCAGAUGCUUGUGGU
961 picture button
rno-miR-106b* miR-106* Rattus norvegicus
CCGCACUGUGGGUACUUGCUGC
657 picture button
rno-miR-106b miR-106 Rattus norvegicus
UAAAGUGCUGACAGUGCAGAU
1037 picture button
rno-miR-107 miR-107 Rattus norvegicus
AGCAGCAUUGUACAGGGCUAUCA
865 picture button
rno-miR-122 miR-122 Rattus norvegicus
UGGAGUGUGACAAUGGUGUUUG
783 picture button
rno-miR-124* miR-124* Rattus norvegicus
CGUGUUCACAGCGGACCUUGAU
740 picture button
rno-miR-124 miR-124 Rattus norvegicus
UAAGGCACGCGGUGAAUGCC
991 picture button
rno-miR-125b-5p miR-125 Rattus norvegicus
UCCCUGAGACCCUAACUUGUGA
1151 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer