spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 7 of 7
<< prev 1 2 3 4 5 6 7

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-764-5p miR-764 Mus musculus
GGUGCUCACAUGUCCUCCU
239 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
201 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
179 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
195 picture button
hsa-miR-767-3p miR-767 Homo sapiens
UCUGCUCAUACCCCAUGGUUUCU
263 picture button
hsa-miR-768-5p miR-768 Homo sapiens
GUUGGAGGAUGAAAGUACGGAGUGAU
234 picture button
hsa-miR-768-3p miR-768 Homo sapiens
UCACAAUGCUGACACUCAAACUGCUGAC
230 picture button
hsa-miR-769-3p miR-769 Homo sapiens
CUGGGAUCUCCGGGGUCUUGGUU
272 picture button
hsa-miR-769-5p miR-769 Homo sapiens
UGAGACCUCUGGGUUCUGAGCU
260 picture button
hsa-miR-770-5p miR-770 Homo sapiens
UCCAGUACCACGUGUCAGGGCCA
218 picture button
hsa-miR-801 miR-801 Homo sapiens
GAUUGCUCUGCGUGCGGAAUCGAC
202 picture button
hsa-miR-802 miR-802 Homo sapiens
CAGUAACAAAGAUUCAUCCUUGU
205 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
203 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
195 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
224 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
212 picture button
hsa-miR-873 miR-873 Homo sapiens
GCAGGAACUUGUGAGUCUCCU
242 picture button
hsa-miR-874 miR-874 Homo sapiens
CUGCCCUGGCCCGAGGGACCGA
268 picture button
hsa-miR-875-5p miR-875 Homo sapiens
UAUACCUCAGUUUUAUCAGGUG
225 picture button
hsa-miR-875-3p miR-875 Homo sapiens
CCUGGAAACACUGAGGUUGUG
216 picture button
hsa-miR-876-3p miR-876 Homo sapiens
UGGUGGUUUACAAAGUAAUUCA
261 picture button
hsa-miR-876-5p miR-876 Homo sapiens
UGGAUUUCUUUGUGAAUCACCA
245 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
175 picture button
mmu-miR-878-3p miR-878 Mus musculus
GCAUGACACCACACUGGGUAGA
233 picture button
mmu-miR-878-5p miR-878 Mus musculus
UAUCUAGUUGGAUGUCAAGACA
239 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
185 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
187 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
181 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
149 picture button
mmu-miR-883b-3p miR-883 Mus musculus
UAACUGCAACAUCUCUCAGUAU
249 picture button
mmu-miR-883a-5p miR-883 Mus musculus
UGCUGAGAGAAGUAGCAGUUAC
223 picture button
mmu-miR-883b-5p miR-883 Mus musculus
UACUGAGAAUGGGUAGCAGUCA
275 picture button
mmu-miR-883a-3p miR-883 Mus musculus
UAACUGCAACAGCUCUCAGUAU
245 picture button
hsa-miR-885-3p miR-885 Homo sapiens
AGGCAGCGGGGUGUAGUGGAUA
260 picture button
hsa-miR-885-5p miR-885 Homo sapiens
UCCAUUACACUACCCUGCCUCU
205 picture button
hsa-miR-886-5p miR-886 Homo sapiens
CGGGUCGGAGUUAGCUCAAGCGG
303 picture button
hsa-miR-886-3p miR-886 Homo sapiens
CGCGGGUGCUUACUGACCCUU
268 picture button
hsa-miR-887 miR-887 Homo sapiens
GUGAACGGGCGCCAUCCCGAGG
222 picture button
hsa-miR-888 miR-888 Homo sapiens
UACUCAAAAAGCUGUCAGUCA
227 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
183 picture button
hsa-miR-890 miR-890 Homo sapiens
UACUUGGAAAGGCAUCAGUUG
219 picture button
hsa-miR-891a miR-891 Homo sapiens
UGCAACGAACCUGAGCCACUGA
250 picture button
hsa-miR-891b miR-891 Homo sapiens
UGCAACUUACCUGAGUCAUUGA
225 picture button
hsa-miR-892b miR-892 Homo sapiens
CACUGGCUCCUUUCUGGGUAGA
211 picture button
hsa-miR-892a miR-892 Homo sapiens
CACUGUGUCCUUUCUGCGUAG
247 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
217 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
184 picture button
hsa-miR-922 miR-922 Homo sapiens
GCAGCAGAGAAUAGGACUACGUC
203 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
200 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
212 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
214 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
192 picture button
hsa-miR-935 miR-935 Homo sapiens
CCAGUUACCGCUUCCGCUACCGC
199 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
192 picture button
hsa-miR-937 miR-937 Homo sapiens
AUCCGCGCUCUGACUCUCUGCC
265 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
189 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
227 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
199 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
216 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
158 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
197 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
185 picture button

Page 7 of 7
<< prev 1 2 3 4 5 6 7

spacer
spacer