spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-486-5p miR-486 Homo sapiens
UCCUGUACUGAGCUGCCCCGAG
239 picture button
hsa-miR-487b miR-487 Homo sapiens
AAUCGUACAGGGUCAUCCACUU
231 picture button
hsa-miR-487a miR-487 Homo sapiens
AAUCAUACAGGGACAUCCAGUU
234 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
203 picture button
hsa-miR-489 miR-489 Homo sapiens
GUGACAUCACAUAUACGGCAGC
254 picture button
hsa-miR-490-3p miR-490 Homo sapiens
CAACCUGGAGGACUCCAUGCUG
199 picture button
hsa-miR-490-5p miR-490 Homo sapiens
CCAUGGAUCUCCAGGUGGGU
232 picture button
hsa-miR-491-3p miR-491 Homo sapiens
CUUAUGCAAGAUUCCCUUCUAC
249 picture button
hsa-miR-491-5p miR-491 Homo sapiens
AGUGGGGAACCCUUCCAUGAGG
235 picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
215 picture button
hsa-miR-493 miR-493 Homo sapiens
UGAAGGUCUACUGUGUGCCAGG
246 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
183 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
234 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
207 picture button
hsa-miR-497 miR-497 Homo sapiens
CAGCAGCACACUGUGGUUUGU
254 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
239 picture button
hsa-miR-499-5p miR-499 Homo sapiens
UUAAGACUUGCAGUGAUGUUU
226 picture button
hsa-miR-499-3p miR-499 Homo sapiens
AACAUCACAGCAAGUCUGUGCU
224 picture button
hsa-miR-500 miR-500 Homo sapiens
UAAUCCUUGCUACCUGGGUGAGA
166 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
216 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
249 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
238 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
226 picture button
hsa-miR-503 miR-503 Homo sapiens
UAGCAGCGGGAACAGUUCUGCAG
255 picture button
hsa-miR-504 miR-504 Homo sapiens
AGACCCUGGUCUGCACUCUAUC
193 picture button
hsa-miR-505 miR-505 Homo sapiens
CGUCAACACUUGCUGGUUUCCU
203 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
233 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
246 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
191 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
224 picture button
hsa-miR-509-3p miR-509 Homo sapiens
UGAUUGGUACGUCUGUGGGUAG
255 picture button
hsa-miR-509-3-5p miR-509 Homo sapiens
UACUGCAGACGUGGCAAUCAUG
232 picture button
hsa-miR-509-5p miR-509 Homo sapiens
UACUGCAGACAGUGGCAAUCA
227 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
208 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
185 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
214 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
243 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
203 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
214 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
216 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
269 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
245 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
226 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
269 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
227 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
244 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
255 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
251 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
248 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
282 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
304 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
286 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
279 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
271 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
279 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
298 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
298 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
252 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
287 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
246 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
301 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
259 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
241 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
247 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
242 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
278 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
251 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
273 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
229 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
261 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
248 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
213 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
190 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
225 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
243 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
220 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
227 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
242 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
217 picture button
hsa-miR-532-3p miR-532 Homo sapiens
CCUCCCACACCCAAGGCUUGCA
243 picture button
hsa-miR-532-5p miR-532 Homo sapiens
CAUGCCUUGAGUGUAGGACCGU
256 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
168 picture button
mmu-miR-540-3p miR-540 Mus musculus
AGGUCAGAGGUCGAUCCUGG
263 picture button
mmu-miR-540-5p miR-540 Mus musculus
CAAGGGUCACCCUCUGACUCUGU
237 picture button
hsa-miR-541 miR-541 Homo sapiens
UGGUGGGCACAGAAUCUGGACU
223 picture button
hsa-miR-542-3p miR-542 Homo sapiens
UGUGACAGAUUGAUAACUGAAA
231 picture button
hsa-miR-542-5p miR-542 Homo sapiens
UCGGGGAUCAUCAUGUCACGAGA
248 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
230 picture button
hsa-miR-544 miR-544 Homo sapiens
AUUCUGCAUUUUUAGCAAGUUC
211 picture button
hsa-miR-545 miR-545 Homo sapiens
UCAGCAAACAUUUAUUGUGUGC
237 picture button
mmu-miR-546 miR-546 Mus musculus
AUGGUGGCACGGAGUC
207 picture button
mmu-miR-547 miR-547 Mus musculus
CUUGGUACAUCUUUGAGUGAG
219 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
222 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
322 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
227 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
271 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
208 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
303 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
212 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
289 picture button

Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer