spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-344 miR-344 Mus musculus
UGAUCUAGCCAAAGCCUGACUGU
238 picture button
hsa-miR-345 miR-345 Homo sapiens
GCUGACUCCUAGUCCAGGGCUC
242 picture button
hsa-miR-346 miR-346 Homo sapiens
UGUCUGCCCGCAUGCCUGCCUCU
199 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
241 picture button
rno-miR-349 miR-349 Rattus norvegicus
CAGCCCUGCUGUCUUAACCUCU
215 picture button
mmu-miR-350 miR-350 Mus musculus
UUCACAAAGCCCAUACACUUUC
240 picture button
mmu-miR-351 miR-351 Mus musculus
UCCCUGAGGAGCCCUUUGAGCCUG
248 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
169 picture button
hsa-miR-361-5p miR-361 Homo sapiens
UUAUCAGAAUCUCCAGGGGUAC
224 picture button
hsa-miR-361-3p miR-361 Homo sapiens
UCCCCCAGGUGUGAUUCUGAUUU
216 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
243 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
239 picture button
hsa-miR-363 miR-363 Homo sapiens
AAUUGCACGGUAUCCAUCUGUA
213 picture button
hsa-miR-365 miR-365 Homo sapiens
UAAUGCCCCUAAAAAUCCUUAU
246 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
348 picture button
hsa-miR-369-5p miR-369 Homo sapiens
AGAUCGACCGUGUUAUAUUCGC
249 picture button
hsa-miR-369-3p miR-369 Homo sapiens
AAUAAUACAUGGUUGAUCUUU
212 picture button
hsa-miR-370 miR-370 Homo sapiens
GCCUGCUGGGGUGGAACCUGGU
223 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
266 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
242 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
210 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
264 picture button
hsa-miR-374a miR-374 Homo sapiens
UUAUAAUACAACCUGAUAAGUG
162 picture button
hsa-miR-374b miR-374 Homo sapiens
AUAUAAUACAACCUGCUAAGUG
164 picture button
hsa-miR-375 miR-375 Homo sapiens
UUUGUUCGUUCGGCUCGCGUGA
200 picture button
hsa-miR-376a miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCACGU
229 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
235 picture button
hsa-miR-376b miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCAUGUU
231 picture button
hsa-miR-377 miR-377 Homo sapiens
AUCACACAAAGGCAACUUUUGU
219 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
215 picture button
hsa-miR-379 miR-379 Homo sapiens
UGGUAGACUAUGGAACGUAGG
205 picture button
hsa-miR-380 miR-380 Homo sapiens
UAUGUAAUAUGGUCCACAUCUU
178 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
192 picture button
hsa-miR-382 miR-382 Homo sapiens
GAAGUUGUUCGUGGUGGAUUCG
240 picture button
hsa-miR-383 miR-383 Homo sapiens
AGAUCAGAAGGUGAUUGUGGCU
230 picture button
hsa-miR-384 miR-384 Homo sapiens
AUUCCUAGAAAUUGUUCAUA
183 picture button
hsa-miR-409-5p miR-409 Homo sapiens
AGGUUACCCGAGCAACUUUGCAU
240 picture button
hsa-miR-409-3p miR-409 Homo sapiens
GAAUGUUGCUCGGUGAACCCCU
198 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
189 picture button
hsa-miR-411 miR-411 Homo sapiens
UAGUAGACCGUAUAGCGUACG
199 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
198 picture button
hsa-miR-421 miR-421 Homo sapiens
AUCAACAGACAUUAAUUGGGCGC
223 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
220 picture button
hsa-miR-423-3p miR-423 Homo sapiens
AGCUCGGUCUGAGGCCCCUCAGU
260 picture button
hsa-miR-423-5p miR-423 Homo sapiens
UGAGGGGCAGAGAGCGAGACUUU
240 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
255 picture button
hsa-miR-425 miR-425 Homo sapiens
AAUGACACGAUCACUCCCGUUGA
249 picture button
hsa-miR-429 miR-429 Homo sapiens
UAAUACUGUCUGGUAAAACCGU
236 picture button
hsa-miR-431 miR-431 Homo sapiens
UGUCUUGCAGGCCGUCAUGCA
200 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
197 picture button
hsa-miR-433 miR-433 Homo sapiens
AUCAUGAUGGGCUCCUCGGUGU
229 picture button
mmu-miR-434-3p miR-434 Mus musculus
UUUGAACCAUCACUCGACUCCU
250 picture button
mmu-miR-434-5p miR-434 Mus musculus
GCUCGACUCAUGGUUUGAACCA
241 picture button
hsa-miR-448 miR-448 Homo sapiens
UUGCAUAUGUAGGAUGUCCCAU
200 picture button
hsa-miR-449a miR-449 Homo sapiens
UGGCAGUGUAUUGUUAGCUGGU
223 picture button
hsa-miR-449b miR-449 Homo sapiens
AGGCAGUGUAUUGUUAGCUGGC
214 picture button
hsa-miR-450b-3p miR-450 Homo sapiens
UUGGGAUCAUUUUGCAUCCAUA
202 picture button
hsa-miR-450a miR-450 Homo sapiens
UUUUGCGAUGUGUUCCUAAUAU
202 picture button
hsa-miR-450b-5p miR-450 Homo sapiens
UUUUGCAAUAUGUUCCUGAAUA
203 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
244 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
214 picture button
hsa-miR-453 miR-453 Homo sapiens
AGGUUGUCCGUGGUGAGUUCGCA
234 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
231 picture button
hsa-miR-455-5p miR-455 Homo sapiens
UAUGUGCCUUUGGACUACAUCG
219 picture button
hsa-miR-455-3p miR-455 Homo sapiens
GCAGUCCAUGGGCAUAUACAC
270 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
194 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
218 picture button
mmu-miR-463 miR-463 Mus musculus
UGAUAGACACCAUAUAAGGUAG
200 picture button
mmu-miR-464 miR-464 Mus musculus
UACCAAGUUUAUUCUGUGAGAUA
219 picture button
mmu-miR-465a-5p miR-465 Mus musculus
UAUUUAGAAUGGCACUGAUGUGA
223 picture button
mmu-miR-465c-5p miR-465 Mus musculus
UAUUUAGAAUGGCGCUGAUCUG
235 picture button
mmu-miR-465a-3p miR-465 Mus musculus
GAUCAGGGCCUUUCUAAGUAGA
258 picture button
mmu-miR-465b-5p miR-465 Mus musculus
UAUUUAGAAUGGUGCUGAUCUG
227 picture button
mmu-miR-466a-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAAGA
300 picture button
mmu-miR-466f-3p miR-466 Mus musculus
CAUACACACACACAUACACAC
322 picture button
mmu-miR-466d-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAG
289 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
292 picture button
mmu-miR-466g miR-466 Mus musculus
AUACAGACACAUGCACACACA
318 picture button
mmu-miR-466e-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUA
295 picture button
mmu-miR-466c-5p miR-466 Mus musculus
GAUGUGUGUGUGCAUGUACAUA
295 picture button
mmu-miR-466a-5p miR-466 Mus musculus
UAUGUGUGUGUACAUGUACAUA
314 picture button
mmu-miR-466f-5p miR-466 Mus musculus
UACGUGUGUGUGCAUGUGCAUG
329 picture button
mmu-miR-466d-5p miR-466 Mus musculus
UGUGUGUGCGUACAUGUACAUG
338 picture button
mmu-miR-466b-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUG
298 picture button
mmu-miR-466h miR-466 Mus musculus
UGUGUGCAUGUGCUUGUGUGUA
319 picture button
mmu-miR-467e miR-467 Mus musculus
AUAAGUGUGAGCAUGUAUAUGU
243 picture button
mmu-miR-467b miR-467 Mus musculus
GUAAGUGCCUGCAUGUAUAUG
261 picture button
mmu-miR-467d miR-467 Mus musculus
UAAGUGCGCGCAUGUAUAUGCG
262 picture button
mmu-miR-467a miR-467 Mus musculus
UAAGUGCCUGCAUGUAUAUGCG
264 picture button
mmu-miR-467c miR-467 Mus musculus
UAAGUGCGUGCAUGUAUAUGUG
263 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
189 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
179 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
191 picture button
mmu-miR-471 miR-471 Mus musculus
UACGUAGUAUAGUGCUUUUCAC
193 picture button
hsa-miR-483-3p miR-483 Homo sapiens
UCACUCCUCUCCUCCCGUCUU
219 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
220 picture button
hsa-miR-484 miR-484 Homo sapiens
UCAGGCUCAGUCCCCUCCCGAU
245 picture button
hsa-miR-485-3p miR-485 Homo sapiens
GUCAUACACGGCUCUCCUCUCU
245 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
169 picture button
hsa-miR-486-3p miR-486 Homo sapiens
CGGGGCAGCUCAGUACAGGAU
240 picture button

Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer