spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
ptr-miR-183 miR-183 Pan troglodytes
UAUGGCACUGGUAGAAUUCACUG
245 picture button
ptr-miR-184 miR-184 Pan troglodytes
UGGACGGAGAACUGAUAAGGGU
250 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
185 picture button
ptr-miR-186 miR-186 Pan troglodytes
CAAAGAAUUCUCCUUUUGGGCUU
188 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
237 picture button
ptr-miR-188 miR-188 Pan troglodytes
CAUCCCUUGCAUGGUGGAGGGU
227 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
225 picture button
ptr-miR-190 miR-190 Pan troglodytes
UGAUAUGUUUGAUAUAUUAGGU
167 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
222 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
220 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
212 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
223 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
192 picture button
ptr-miR-194 miR-194 Pan troglodytes
UGUAACAGCAACUCCAUGUGGA
215 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
231 picture button
ptr-miR-196 miR-196 Pan troglodytes
UAGGUAGUUUCAUGUUGUUGGG
237 picture button
ptr-miR-197 miR-197 Pan troglodytes
UUCACCACCUUCUCCACCCAGC
208 picture button
ptr-miR-198 miR-198 Pan troglodytes
GGUCCAGAGGGGAGAUAGG
269 picture button
ptr-miR-199a miR-199 Pan troglodytes
CCCAGUGUUCAGACUACCUGUUC
246 picture button
hsa-miR-200a miR-200 Homo sapiens
UAACACUGUCUGGUAACGAUGU
248 picture button
hsa-miR-200c miR-200 Homo sapiens
UAAUACUGCCGGGUAAUGAUGGA
265 picture button
hsa-miR-200b miR-200 Homo sapiens
UAAUACUGCCUGGUAAUGAUGA
269 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
197 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
235 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
186 picture button
ptr-miR-204 miR-204 Pan troglodytes
UUCCCUUUGUCAUCCUAUGCCU
208 picture button
ptr-miR-205 miR-205 Pan troglodytes
UCCUUCAUUCCACCGGAGUCUG
196 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
222 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
139 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
227 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
216 picture button
hsa-miR-210 miR-210 Homo sapiens
CUGUGCGUGUGACAGCGGCUGA
225 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
185 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
231 picture button
ptr-miR-214 miR-214 Pan troglodytes
ACAGCAGGCACAGACAGGCAG
242 picture button
ptr-miR-215 miR-215 Pan troglodytes
AUGACCUAUGAAUUGACAGAC
242 picture button
ptr-miR-216 miR-216 Pan troglodytes
UUAUCUCAGCUGGCAACUGUG
208 picture button
hsa-miR-217 miR-217 Homo sapiens
UACUGCAUCAGGAACUGAUUGGA
243 picture button
ptr-miR-218 miR-218 Pan troglodytes
UUGUGCUUGAUCUAACCAUGU
207 picture button
hsa-miR-219-1-3p miR-219 Homo sapiens
AGAGUUGAGUCUGGACGUCCCG
226 picture button
hsa-miR-219-5p miR-219 Homo sapiens
UGAUUGUCCAAACGCAAUUCU
229 picture button
hsa-miR-219-2-3p miR-219 Homo sapiens
AGAAUUGUGGCUGGACAUCUGU
229 picture button
ptr-miR-220 miR-220 Pan troglodytes
CCACACCGUAUCUGACACUUU
232 picture button
hsa-miR-221 miR-221 Homo sapiens
AGCUACAUUGUCUGCUGGGUUUC
235 picture button
hsa-miR-222 miR-222 Homo sapiens
AGCUACAUCUGGCUACUGGGU
226 picture button
ptr-miR-223 miR-223 Pan troglodytes
UGUCAGUUUGUCAAAUACCCC
228 picture button
ptr-miR-224 miR-224 Pan troglodytes
CAAGUCACUAGUGGUUCCGUUUA
229 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
265 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
250 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
267 picture button
mmu-miR-291a-5p miR-291 Mus musculus
CAUCAAAGUGGAGGCCCUCUCU
243 picture button
mmu-miR-291b-5p miR-291 Mus musculus
GAUCAAAGUGGAGGCCCUCUCC
234 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
228 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
252 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
245 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
209 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
201 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
171 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
249 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
268 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
206 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
218 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
229 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
213 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
205 picture button
hsa-miR-301b miR-301 Homo sapiens
CAGUGCAAUGAUAUUGUCAAAGC
235 picture button
hsa-miR-301a miR-301 Homo sapiens
CAGUGCAAUAGUAUUGUCAAAGC
237 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
217 picture button
hsa-miR-302a miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUGGUGA
220 picture button
hsa-miR-302c miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUCAGUGG
246 picture button
hsa-miR-302b miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUAGUAG
235 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
242 picture button
mmu-miR-322 miR-322 Mus musculus
CAGCAGCAAUUCAUGUUUUGGA
263 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
245 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
266 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
272 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
301 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
190 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
247 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
202 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
227 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
204 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
243 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
221 picture button
hsa-miR-331-5p miR-331 Homo sapiens
CUAGGUAUGGUCCCAGGGAUCC
190 picture button
hsa-miR-331-3p miR-331 Homo sapiens
GCCCCUGGGCCUAUCCUAGAA
250 picture button
rno-miR-333 miR-333 Rattus norvegicus
GUGGUGUGCUAGUUACUUUU
220 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
202 picture button
rno-miR-336 miR-336 Rattus norvegicus
UCACCCUUCCAUAUCUAGUCU
210 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
261 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
229 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
260 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
228 picture button
hsa-miR-339-3p miR-339 Homo sapiens
UGAGCGCCUCGACGACAGAGCCG
274 picture button
hsa-miR-339-5p miR-339 Homo sapiens
UCCCUGUCCUCCAGGAGCUCACG
249 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
164 picture button
mmu-miR-341 miR-341 Mus musculus
UCGGUCGAUCGGUCGGUCGGU
189 picture button
hsa-miR-342-3p miR-342 Homo sapiens
UCUCACACAGAAAUCGCACCCGU
247 picture button
hsa-miR-342-5p miR-342 Homo sapiens
AGGGGUGCUAUCUGUGAUUGA
209 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
174 picture button

Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer