spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
120 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
139 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
144 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
144 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
149 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
156 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
158 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
158 picture button
hsa-miR-374a miR-374 Homo sapiens
UUAUAAUACAACCUGAUAAGUG
162 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
162 picture button
ptr-miR-154 miR-154 Pan troglodytes
UAGGUUAUCCGUGUUGCCUUCG
164 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
164 picture button
hsa-miR-374b miR-374 Homo sapiens
AUAUAAUACAACCUGCUAAGUG
164 picture button
hsa-miR-500 miR-500 Homo sapiens
UAAUCCUUGCUACCUGGGUGAGA
166 picture button
ptr-miR-190 miR-190 Pan troglodytes
UGAUAUGUUUGAUAUAUUAGGU
167 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
167 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
168 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
168 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
168 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
168 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
169 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
169 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
170 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
170 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
170 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
171 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
172 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
174 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
175 picture button
hsa-miR-592 miR-592 Homo sapiens
UUGUGUCAAUAUGCGAUGAUGU
176 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
176 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
176 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
177 picture button
hsa-miR-380 miR-380 Homo sapiens
UAUGUAAUAUGGUCCACAUCUU
178 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
179 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
179 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
179 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
179 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
180 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
181 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
182 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
182 picture button
hsa-miR-384 miR-384 Homo sapiens
AUUCCUAGAAAUUGUUCAUA
183 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
183 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
183 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
183 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
184 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
185 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
185 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
185 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
185 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
185 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
186 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
186 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
187 picture button
ptr-miR-186 miR-186 Pan troglodytes
CAAAGAAUUCUCCUUUUGGGCUU
188 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
188 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
188 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
188 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
188 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
188 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
189 picture button
mmu-miR-341 miR-341 Mus musculus
UCGGUCGAUCGGUCGGUCGGU
189 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
189 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
189 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
189 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
189 picture button
hsa-miR-659 miR-659 Homo sapiens
CUUGGUUCAGGGAGGGUCCCCA
189 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
189 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
190 picture button
hsa-miR-331-5p miR-331 Homo sapiens
CUAGGUAUGGUCCCAGGGAUCC
190 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
190 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
190 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
190 picture button
mmu-miR-707 miR-707 Mus musculus
CAGUCAUGCCGCUUGCCUACG
190 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
191 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
191 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
192 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
192 picture button
mmu-miR-717 miR-717 Mus musculus
CUCAGACAGAGAUACCUUCUCU
192 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
192 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
192 picture button
mmu-miR-471 miR-471 Mus musculus
UACGUAGUAUAGUGCUUUUCAC
193 picture button
hsa-miR-504 miR-504 Homo sapiens
AGACCCUGGUCUGCACUCUAUC
193 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
193 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
193 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
193 picture button
ptr-miR-136 miR-136 Pan troglodytes
ACUCCAUUUGUUUUGAUGAUGGA
194 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
194 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
194 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
194 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
195 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
195 picture button
ptr-miR-98 miR-98 Pan troglodytes
UGAGGUAGUAAGUUGUAUUGUU
196 picture button
ptr-miR-205 miR-205 Pan troglodytes
UCCUUCAUUCCACCGGAGUCUG
196 picture button
mmu-miR-691 miR-691 Mus musculus
AUUCCUGAAGAGAGGCAGAAAA
196 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
197 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
197 picture button
hsa-miR-630 miR-630 Homo sapiens
AGUAUUCUGUACCAGGGAAGGU
197 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
197 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer