spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
247 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
212 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
242 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
208 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
222 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
212 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
227 picture button
ptr-miR-106a miR-106 Pan troglodytes
AAAAGUGCUUACAGUGCAGGUAGC
279 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
190 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
234 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
230 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
244 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
229 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
170 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
201 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
202 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
271 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
200 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
216 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
267 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
287 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
301 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
298 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
252 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
250 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
171 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
210 picture button
ptr-miR-93 miR-93 Pan troglodytes
AAAGUGCUGUUCGUGCAGGUAG
291 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
228 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
259 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
201 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
242 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
248 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
261 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
251 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
185 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
228 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
239 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
204 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
203 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
235 picture button
hsa-miR-499-3p miR-499 Homo sapiens
AACAUCACAGCAAGUCUGUGCU
224 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
252 picture button
ptr-miR-181c miR-181 Pan troglodytes
AACAUUCAACCUGUCGGUGAGU
264 picture button
ptr-miR-181a miR-181 Pan troglodytes
AACAUUCAACGCUGUCGGUGAGU
262 picture button
ptr-miR-181b miR-181 Pan troglodytes
AACAUUCAUUGCUGUCGGUGGGUU
264 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
247 picture button
ptr-miR-100 miR-100 Pan troglodytes
AACCCGUAGAUCCGAACUUGUG
220 picture button
ptr-miR-99a miR-99 Pan troglodytes
AACCCGUAGAUCCGAUCUUGUG
221 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
213 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
212 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
192 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
181 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
214 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
220 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
243 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
245 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
225 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
201 picture button
ptr-miR-22 miR-22 Pan troglodytes
AAGCUGCCAGUUGAAGAACUGU
244 picture button
ptr-miR-28 miR-28 Pan troglodytes
AAGGAGCUCACAGUCUAUUGAG
245 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
198 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
199 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
212 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
242 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
252 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
243 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
278 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
243 picture button
hsa-miR-369-3p miR-369 Homo sapiens
AAUAAUACAUGGUUGAUCUUU
212 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
292 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
189 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
167 picture button
hsa-miR-487a miR-487 Homo sapiens
AAUCAUACAGGGACAUCCAGUU
234 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
243 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
216 picture button
hsa-miR-487b miR-487 Homo sapiens
AAUCGUACAGGGUCAUCCACUU
231 picture button
hsa-miR-425 miR-425 Homo sapiens
AAUGACACGAUCACUCCCGUUGA
249 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
249 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
238 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
224 picture button
hsa-miR-363 miR-363 Homo sapiens
AAUUGCACGGUAUCCAUCUGUA
213 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
348 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
229 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
241 picture button
ptr-miR-214 miR-214 Pan troglodytes
ACAGCAGGCACAGACAGGCAG
242 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
192 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
200 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
225 picture button
ptr-miR-181a* miR-181* Pan troglodytes
ACCAUCGACCGUUGAUUGUACC
212 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
265 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
245 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
266 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
179 picture button
ptr-miR-136 miR-136 Pan troglodytes
ACUCCAUUUGUUUUGAUGAUGGA
194 picture button
ptr-miR-17-3p miR-17 Pan troglodytes
ACUGCAGUGAAGGCACUUGU
251 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
301 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
220 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
215 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
234 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer