spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
194 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
218 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
223 picture button
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
227 picture button
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
226 picture button
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
217 picture button
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
232 picture button
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
224 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
202 picture button
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
232 picture button
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
217 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
219 picture button
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
213 picture button
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
213 picture button
hsa-miR-122 miR-122 Homo sapiens
UGGAGUGUGACAAUGGUGUUUG
224 picture button
hsa-miR-126 miR-126 Homo sapiens
UCGUACCGUGAGUAAUAAUGCG
221 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
225 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
202 picture button
hsa-miR-130a miR-130 Homo sapiens
CAGUGCAAUGUUAAAAGGGCAU
238 picture button
hsa-miR-130b miR-130 Homo sapiens
CAGUGCAAUGAUGAAAGGGCAU
271 picture button
hsa-miR-132 miR-132 Homo sapiens
UAACAGUCUACAGCCAUGGUCG
252 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
203 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
236 picture button
hsa-miR-138 miR-138 Homo sapiens
AGCUGGUGUUGUGAAUCAGGCCG
217 picture button
hsa-miR-139-3p miR-139 Homo sapiens
GGAGACGCGGCCCUGUUGGAGU
235 picture button
hsa-miR-139-5p miR-139 Homo sapiens
UCUACAGUGCACGUGUCUCCAG
234 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
236 picture button
hsa-miR-142-3p miR-142 Homo sapiens
UGUAGUGUUUCCUACUUUAUGGA
214 picture button
hsa-miR-142-5p miR-142 Homo sapiens
CAUAAAGUAGAAAGCACUACU
205 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
236 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
252 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
228 picture button
hsa-miR-148a miR-148 Homo sapiens
UCAGUGCACUACAGAACUUUGU
229 picture button
hsa-miR-148b miR-148 Homo sapiens
UCAGUGCAUCACAGAACUUUGU
258 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
189 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
194 picture button
hsa-miR-151-3p miR-151 Homo sapiens
CUAGACUGAAGCUCCUUGAGG
200 picture button
hsa-miR-151-5p miR-151 Homo sapiens
UCGAGGAGCUCACAGUCUAGU
228 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
241 picture button
hsa-miR-153 miR-153 Homo sapiens
UUGCAUAGUCACAAAAGUGAUC
240 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
215 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
220 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
185 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
237 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
222 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
220 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
192 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
223 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
212 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
231 picture button
hsa-miR-200a miR-200 Homo sapiens
UAACACUGUCUGGUAACGAUGU
248 picture button
hsa-miR-200b miR-200 Homo sapiens
UAAUACUGCCUGGUAAUGAUGA
269 picture button
hsa-miR-200c miR-200 Homo sapiens
UAAUACUGCCGGGUAAUGAUGGA
265 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
235 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
186 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
222 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
216 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
227 picture button
hsa-miR-210 miR-210 Homo sapiens
CUGUGCGUGUGACAGCGGCUGA
225 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
185 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
231 picture button
hsa-miR-217 miR-217 Homo sapiens
UACUGCAUCAGGAACUGAUUGGA
243 picture button
hsa-miR-219-1-3p miR-219 Homo sapiens
AGAGUUGAGUCUGGACGUCCCG
226 picture button
hsa-miR-219-2-3p miR-219 Homo sapiens
AGAAUUGUGGCUGGACAUCUGU
229 picture button
hsa-miR-219-5p miR-219 Homo sapiens
UGAUUGUCCAAACGCAAUUCU
229 picture button
hsa-miR-221 miR-221 Homo sapiens
AGCUACAUUGUCUGCUGGGUUUC
235 picture button
hsa-miR-222 miR-222 Homo sapiens
AGCUACAUCUGGCUACUGGGU
226 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
268 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
249 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
206 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
218 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
213 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
229 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
205 picture button
hsa-miR-301a miR-301 Homo sapiens
CAGUGCAAUAGUAUUGUCAAAGC
237 picture button
hsa-miR-301b miR-301 Homo sapiens
CAGUGCAAUGAUAUUGUCAAAGC
235 picture button
hsa-miR-302a miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUGGUGA
220 picture button
hsa-miR-302b miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUAGUAG
235 picture button
hsa-miR-302c miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUCAGUGG
246 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
217 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
242 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
245 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
266 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
301 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
272 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
190 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
247 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
227 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
204 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
221 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
243 picture button
hsa-miR-331-3p miR-331 Homo sapiens
GCCCCUGGGCCUAUCCUAGAA
250 picture button
hsa-miR-331-5p miR-331 Homo sapiens
CUAGGUAUGGUCCCAGGGAUCC
190 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
202 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
229 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
261 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
260 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
228 picture button
hsa-miR-339-3p miR-339 Homo sapiens
UGAGCGCCUCGACGACAGAGCCG
274 picture button
hsa-miR-339-5p miR-339 Homo sapiens
UCCCUGUCCUCCAGGAGCUCACG
249 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer