spacer

MicroRNA Listing for Pan troglodytes


662 microRNAs (80 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
227 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
202 picture button
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
217 picture button
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
217 picture button
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
224 picture button
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
226 picture button
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
232 picture button
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
232 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
219 picture button
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
213 picture button
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
213 picture button
ptr-miR-100 miR-100 Pan troglodytes
AACCCGUAGAUCCGAACUUGUG
220 picture button
ptr-miR-101 miR-101 Pan troglodytes
UACAGUACUGUGAUAACUGAAG
247 picture button
ptr-miR-103 miR-103 Pan troglodytes
AGCAGCAUUGUACAGGGCUAUGA
235 picture button
ptr-miR-105 miR-105 Pan troglodytes
UCAAAUGCUCAGACUCCUGU
223 picture button
ptr-miR-106b miR-106 Pan troglodytes
UAAAGUGCUGACAGUGCAGAU
309 picture button
ptr-miR-106a miR-106 Pan troglodytes
AAAAGUGCUUACAGUGCAGGUAGC
279 picture button
ptr-miR-107 miR-107 Pan troglodytes
AGCAGCAUUGUACAGGGCUAUCA
224 picture button
hsa-miR-122 miR-122 Homo sapiens
UGGAGUGUGACAAUGGUGUUUG
224 picture button
ptr-miR-124a miR-124 Pan troglodytes
UUAAGGCACGCGGUGAAUGCCA
224 picture button
ptr-miR-125b miR-125 Pan troglodytes
UCCCUGAGACCCUAACUUGUGA
301 picture button
hsa-miR-126 miR-126 Homo sapiens
UCGUACCGUGAGUAAUAAUGCG
221 picture button
ptr-miR-127 miR-127 Pan troglodytes
UCGGAUCCGUCUGAGCUUGGCU
216 picture button
ptr-miR-128a miR-128 Pan troglodytes
UCACAGUGAACCGGUCUCUUUU
269 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
225 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
202 picture button
hsa-miR-130a miR-130 Homo sapiens
CAGUGCAAUGUUAAAAGGGCAU
238 picture button
hsa-miR-130b miR-130 Homo sapiens
CAGUGCAAUGAUGAAAGGGCAU
271 picture button
hsa-miR-132 miR-132 Homo sapiens
UAACAGUCUACAGCCAUGGUCG
252 picture button
ptr-miR-133a miR-133 Pan troglodytes
UUGGUCCCCUUCAACCAGCUG
233 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
203 picture button
ptr-miR-135 miR-135 Pan troglodytes
UAUGGCUUUUUAUUCCUAUGUGA
248 picture button
ptr-miR-136 miR-136 Pan troglodytes
ACUCCAUUUGUUUUGAUGAUGGA
194 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
236 picture button
hsa-miR-138 miR-138 Homo sapiens
AGCUGGUGUUGUGAAUCAGGCCG
217 picture button
hsa-miR-139-5p miR-139 Homo sapiens
UCUACAGUGCACGUGUCUCCAG
234 picture button
hsa-miR-139-3p miR-139 Homo sapiens
GGAGACGCGGCCCUGUUGGAGU
235 picture button
ptr-miR-140 miR-140 Pan troglodytes
AGUGGUUUUACCCUAUGGUAG
211 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
236 picture button
hsa-miR-142-5p miR-142 Homo sapiens
CAUAAAGUAGAAAGCACUACU
205 picture button
hsa-miR-142-3p miR-142 Homo sapiens
UGUAGUGUUUCCUACUUUAUGGA
214 picture button
ptr-miR-143 miR-143 Pan troglodytes
UGAGAUGAAGCACUGUAGCUCA
223 picture button
ptr-miR-144 miR-144 Pan troglodytes
UACAGUAUAGAUGAUGUACUAG
270 picture button
ptr-miR-145 miR-145 Pan troglodytes
GUCCAGUUUUCCCAGGAAUCCCUU
259 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
252 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
236 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
228 picture button
ptr-miR-147 miR-147 Pan troglodytes
GUGUGUGGAAAUGCUUCUGC
231 picture button
hsa-miR-148a miR-148 Homo sapiens
UCAGUGCACUACAGAACUUUGU
229 picture button
hsa-miR-148b miR-148 Homo sapiens
UCAGUGCAUCACAGAACUUUGU
258 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
189 picture button
ptr-miR-15b miR-15 Pan troglodytes
UAGCAGCACAUCAUGGUUUACA
262 picture button
ptr-miR-15a miR-15 Pan troglodytes
UAGCAGCACAUAAUGGUUUGUG
273 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
194 picture button
hsa-miR-151-5p miR-151 Homo sapiens
UCGAGGAGCUCACAGUCUAGU
228 picture button
hsa-miR-151-3p miR-151 Homo sapiens
CUAGACUGAAGCUCCUUGAGG
200 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
241 picture button
hsa-miR-153 miR-153 Homo sapiens
UUGCAUAGUCACAAAAGUGAUC
240 picture button
ptr-miR-154 miR-154 Pan troglodytes
UAGGUUAUCCGUGUUGCCUUCG
164 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
215 picture button
ptr-miR-16 miR-16 Pan troglodytes
UAGCAGCACGUAAAUAUUGGCG
258 picture button
ptr-miR-17-3p miR-17 Pan troglodytes
ACUGCAGUGAAGGCACUUGU
251 picture button
ptr-miR-17-5p miR-17 Pan troglodytes
CAAAGUGCUUACAGUGCAGGUAGU
337 picture button
ptr-miR-18 miR-18 Pan troglodytes
UAAGGUGCAUCUAGUGCAGAUA
242 picture button
ptr-miR-181a miR-181 Pan troglodytes
AACAUUCAACGCUGUCGGUGAGU
262 picture button
ptr-miR-181c miR-181 Pan troglodytes
AACAUUCAACCUGUCGGUGAGU
264 picture button
ptr-miR-181b miR-181 Pan troglodytes
AACAUUCAUUGCUGUCGGUGGGUU
264 picture button
ptr-miR-181a* miR-181* Pan troglodytes
ACCAUCGACCGUUGAUUGUACC
212 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
220 picture button
ptr-miR-183 miR-183 Pan troglodytes
UAUGGCACUGGUAGAAUUCACUG
245 picture button
ptr-miR-184 miR-184 Pan troglodytes
UGGACGGAGAACUGAUAAGGGU
250 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
185 picture button
ptr-miR-186 miR-186 Pan troglodytes
CAAAGAAUUCUCCUUUUGGGCUU
188 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
237 picture button
ptr-miR-188 miR-188 Pan troglodytes
CAUCCCUUGCAUGGUGGAGGGU
227 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
225 picture button
ptr-miR-19b miR-19 Pan troglodytes
UGUGCAAAUCCAUGCAAAACUGA
269 picture button
ptr-miR-19a miR-19 Pan troglodytes
UGUGCAAAUCUAUGCAAAACUGA
268 picture button
ptr-miR-190 miR-190 Pan troglodytes
UGAUAUGUUUGAUAUAUUAGGU
167 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
222 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
220 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
223 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
192 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
212 picture button
ptr-miR-194 miR-194 Pan troglodytes
UGUAACAGCAACUCCAUGUGGA
215 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
231 picture button
ptr-miR-196 miR-196 Pan troglodytes
UAGGUAGUUUCAUGUUGUUGGG
237 picture button
ptr-miR-197 miR-197 Pan troglodytes
UUCACCACCUUCUCCACCCAGC
208 picture button
ptr-miR-198 miR-198 Pan troglodytes
GGUCCAGAGGGGAGAUAGG
269 picture button
ptr-miR-199a miR-199 Pan troglodytes
CCCAGUGUUCAGACUACCUGUUC
246 picture button
ptr-miR-20 miR-20 Pan troglodytes
UAAAGUGCUUAUAGUGCAGGUA
314 picture button
hsa-miR-200c miR-200 Homo sapiens
UAAUACUGCCGGGUAAUGAUGGA
265 picture button
hsa-miR-200b miR-200 Homo sapiens
UAAUACUGCCUGGUAAUGAUGA
269 picture button
hsa-miR-200a miR-200 Homo sapiens
UAACACUGUCUGGUAACGAUGU
248 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
197 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
235 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
186 picture button
ptr-miR-204 miR-204 Pan troglodytes
UUCCCUUUGUCAUCCUAUGCCU
208 picture button
ptr-miR-205 miR-205 Pan troglodytes
UCCUUCAUUCCACCGGAGUCUG
196 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
222 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer