spacer

MicroRNA Listing for Oryzias latipes


172 microRNAs (0 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
745 picture button
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
781 picture button
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
811 picture button
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
755 picture button
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
841 picture button
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
810 picture button
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
774 picture button
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
807 picture button
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
612 picture button
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
598 picture button
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
629 picture button
fru-miR-10d miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUGUGUGUG
792 picture button
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
782 picture button
fru-miR-10b miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUUUGUG
780 picture button
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
756 picture button
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
742 picture button
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
717 picture button
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
865 picture button
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
725 picture button
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
781 picture button
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
761 picture button
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
870 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
721 picture button
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
780 picture button
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
789 picture button
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
722 picture button
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
676 picture button
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
742 picture button
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
794 picture button
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
781 picture button
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
842 picture button
fru-miR-27e miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCAGUG
837 picture button
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
861 picture button
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
832 picture button
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
836 picture button
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
835 picture button
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
813 picture button
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
755 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
631 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
756 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
768 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
767 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
785 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
775 picture button
fru-miR-92 miR-92 Takifugu rubripes
UAUUGCACUUGUCCCGGCCUGU
839 picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
762 picture button
fru-miR-96 miR-96 Takifugu rubripes
UUUGGCACUAGCACAUUUUUGCU
778 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
621 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
721 picture button
fru-miR-100 miR-100 Takifugu rubripes
AACCCGUAGAUCCGAACUUGUG
691 picture button
fru-miR-101a miR-101 Takifugu rubripes
UACAGUACUGUGAUAACUGAAG
850 picture button
fru-miR-101b miR-101 Takifugu rubripes
UACAGUACUAUGAUAACUGAAG
852 picture button
fru-miR-103 miR-103 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUGA
777 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
846 picture button
fru-miR-107 miR-107 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUCA
771 picture button
fru-miR-122 miR-122 Takifugu rubripes
UGGAGUGUGACAAUGGUGUUUG
624 picture button
fru-miR-124 miR-124 Takifugu rubripes
UAAGGCACGCGGUGAAUGCCAA
800 picture button
fru-miR-125b miR-125 Takifugu rubripes
UCCCUGAGACCCUAACUUGUGA
819 picture button
fru-miR-125a miR-125 Takifugu rubripes
UCCCUGAGACCCUUAACCUGUG
806 picture button
fru-miR-126 miR-126 Takifugu rubripes
UCGUACCGUGAGUAAUAAUGC
650 picture button
fru-miR-128 miR-128 Takifugu rubripes
UCACAGUGAACCGGUCUCUUUU
729 picture button
fru-miR-129 miR-129 Takifugu rubripes
CUUUUUGCGGUCUGGGCUUGCU
568 picture button
fru-miR-130 miR-130 Takifugu rubripes
CAGUGCAAUAUUAAAAGGGCAU
769 picture button
fru-miR-132 miR-132 Takifugu rubripes
UAACAGUCUACAGCCAUGGUCG
887 picture button
fru-miR-133 miR-133 Takifugu rubripes
UUUGGUCCCCUUCAACCAGCUG
743 picture button
fru-miR-135b miR-135 Takifugu rubripes
UAUGGCUUUUUAUUCCUAUCUG
759 picture button
fru-miR-135a miR-135 Takifugu rubripes
UAUGGCUUUCUAUUCCUAUGUG
738 picture button
fru-miR-137 miR-137 Takifugu rubripes
UUAUUGCUUAAGAAUACGCGUA
723 picture button
fru-miR-138 miR-138 Takifugu rubripes
AGCUGGUGUUGUGAAUCAGGCC
667 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
713 picture button
fru-miR-140 miR-140 Takifugu rubripes
CAGUGGUUUUACCCUAUGGUAG
666 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
918 picture button
fru-miR-142a miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACU
523 picture button
fru-miR-142b miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACUA
529 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
607 picture button
fru-miR-144 miR-144 Takifugu rubripes
UACAGUAUAGAUGAUGUACU
817 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
801 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
708 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
727 picture button
fru-miR-148 miR-148 Takifugu rubripes
UCAGUGCAUUACAGAACUUUGU
779 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
684 picture button
fru-miR-152 miR-152 Takifugu rubripes
UCAGUGCAUAACAGAACUUUGU
809 picture button
fru-miR-153b miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAAUGAGC
744 picture button
fru-miR-153a miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAGUGAUC
727 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
703 picture button
fru-miR-181a miR-181 Takifugu rubripes
AACAUUCAACGCUGUCGGUGAGU
873 picture button
fru-miR-181b miR-181 Takifugu rubripes
AACAUUCAUUGCUGUCGGUGGG
889 picture button
fru-miR-182 miR-182 Takifugu rubripes
UGGUUCUAGACUUGCCAACUA
654 picture button
fru-miR-183 miR-183 Takifugu rubripes
UAUGGCACUGGUAGAAUUCACUG
760 picture button
fru-miR-184 miR-184 Takifugu rubripes
UGGACGGAGAACUGAUAAGGG
606 picture button
fru-miR-187 miR-187 Takifugu rubripes
UCGUGUCUUGUGUUGCAGCC
644 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
648 picture button
fru-miR-190 miR-190 Takifugu rubripes
UGAUAUGUUUGAUAUAUUAGGU
569 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
667 picture button
fru-miR-192 miR-192 Takifugu rubripes
AUGACCUAUGAAUUGACAGCC
727 picture button
fru-miR-193 miR-193 Takifugu rubripes
AACUGGCCUACAAAGUCCCAGU
731 picture button
fru-miR-194 miR-194 Takifugu rubripes
UGUAACAGCAACUCCAUGUGG
731 picture button
fru-miR-196a miR-196 Takifugu rubripes
UAGGUAGUUUCAUGUUGUUGGG
670 picture button
fru-miR-196b miR-196 Takifugu rubripes
UAGGUAGUUUCAAGUUGUUGGG
685 picture button
fru-miR-199 miR-199 Takifugu rubripes
CCCAGUGUUCAGACUACCUGUUC
834 picture button

Page 1 of 2
1 2 next >>

spacer
spacer