spacer

MicroRNA Listing for Ornithorhynchus anatinus


668 microRNAs (0 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
566 picture button
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
583 picture button
bta-let-7f let-7 Bos taurus
UGAGGUAGUAGAUUGUAUAGUU
593 picture button
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
613 picture button
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
628 picture button
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
601 picture button
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
613 picture button
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
579 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
521 picture button
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
612 picture button
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
525 picture button
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
723 picture button
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
715 picture button
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
798 picture button
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
765 picture button
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
713 picture button
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
757 picture button
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
574 picture button
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
666 picture button
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
672 picture button
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
671 picture button
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
696 picture button
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
525 picture button
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
568 picture button
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
625 picture button
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
567 picture button
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
709 picture button
bta-miR-23b miR-23 Bos taurus
AUCACAUUGCCAGGGAUUACCAC
705 picture button
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
654 picture button
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
726 picture button
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
663 picture button
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
640 picture button
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
582 picture button
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
616 picture button
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
763 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
702 picture button
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
750 picture button
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
792 picture button
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
756 picture button
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
807 picture button
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
704 picture button
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
791 picture button
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
767 picture button
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
747 picture button
bta-miR-31 miR-31 Bos taurus
AGGCAAGAUGCUGGCAUAGCU
656 picture button
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
584 picture button
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
654 picture button
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
656 picture button
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
697 picture button
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
726 picture button
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
725 picture button
bta-miR-92 miR-92 Bos taurus
UAUUGCACUUGUCCCGGCCUGU
734 picture button
bta-miR-93 miR-93 Bos taurus
CAAAGUGCUGUUCGUGCAGGUA
591 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
690 picture button
hsa-miR-96 miR-96 Homo sapiens
UUUGGCACUAGCACAUUUUUGCU
667 picture button
bta-miR-98 miR-98 Bos taurus
UGAGGUAGUAAGUUGUAUUGUU
433 picture button
bta-miR-99b miR-99 Bos taurus
CACCCGUAGAACCGACCUUGCG
661 picture button
bta-miR-99a miR-99 Bos taurus
AACCCGUAGAUCCGAUCUUGU
649 picture button
hsa-miR-100 miR-100 Homo sapiens
AACCCGUAGAUCCGAACUUGUG
604 picture button
bta-miR-101 miR-101 Bos taurus
UACAGUACUGUGAUAACUGAA
721 picture button
bta-miR-103 miR-103 Bos taurus
AGCAGCAUUGUACAGGGCUAUGA
739 picture button
hsa-miR-105 miR-105 Homo sapiens
UCAAAUGCUCAGACUCCUGUGGU
537 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
514 picture button
bta-miR-107 miR-107 Bos taurus
AGCAGCAUUGUACAGGGCUAUC
723 picture button
bta-miR-122 miR-122 Bos taurus
UGGAGUGUGACAAUGGUGUUUG
567 picture button
bta-miR-124a miR-124 Bos taurus
UUAAGGCACGCGGUGAAUGCCAA
642 picture button
bta-miR-125a miR-125 Bos taurus
UCCCUGAGACCCUUUAACCUGUG
682 picture button
bta-miR-125b miR-125 Bos taurus
UCCCUGAGACCCUAACUUGUGA
721 picture button
bta-miR-126 miR-126 Bos taurus
CGUACCGUGAGUAAUAAUGCG
623 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
575 picture button
bta-miR-128a miR-128 Bos taurus
UCACAGUGAACCGGUCUCUUUU
591 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
664 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
629 picture button
hsa-miR-130b miR-130 Homo sapiens
CAGUGCAAUGAUGAAAGGGCAU
691 picture button
hsa-miR-130a miR-130 Homo sapiens
CAGUGCAAUGUUAAAAGGGCAU
712 picture button
bta-miR-132 miR-132 Bos taurus
UAACAGUCUACAGCCAUGGUCG
605 picture button
hsa-miR-133a miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUG
560 picture button
hsa-miR-133b miR-133 Homo sapiens
UUUGGUCCCCUUCAACCAGCUA
579 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
594 picture button
hsa-miR-135a miR-135 Homo sapiens
UAUGGCUUUUUAUUCCUAUGUGA
705 picture button
hsa-miR-135b miR-135 Homo sapiens
UAUGGCUUUUCAUUCCUAUGUGA
695 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
467 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
611 picture button
bta-miR-138 miR-138 Bos taurus
AGCUGGUGUUGUGAAUCAGGCCG
660 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
556 picture button
bta-miR-140 miR-140 Bos taurus
UACCACAGGGUAGAACCACGGA
723 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
749 picture button
bta-miR-142 miR-142 Bos taurus
CAUAAAGUAGAAAGCACUAC
530 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
502 picture button
hsa-miR-144 miR-144 Homo sapiens
UACAGUAUAGAUGAUGUACU
618 picture button
bta-miR-145 miR-145 Bos taurus
GUCCAGUUUUCCCAGGAAUCCCU
626 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
625 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
676 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
640 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
642 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
640 picture button
bta-miR-148b miR-148 Bos taurus
UCAGUGCAUCACAGAACUUUGU
727 picture button
bta-miR-148a miR-148 Bos taurus
UCAGUGCACUACAGAACUUUGU
699 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
401 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
786 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer