spacer

MicroRNA Listing for Monodelphis domestica


644 microRNAs (99 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mdo-let-7a let-7 Monodelphis domestica
UGAGGUAGUAGGUUGUAUAGUU
803 picture button
mdo-let-7i let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUGCUGU
789 picture button
mdo-let-7d let-7 Monodelphis domestica
AGAGGUAGUAGGUUGCAUAGU
794 picture button
mdo-let-7g let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUACAGU
785 picture button
mdo-let-7b let-7 Monodelphis domestica
UGAGGUAGUAGGUUGUGUGGUU
811 picture button
mdo-let-7f let-7 Monodelphis domestica
UGAGGUAGUAGAUUGUAUAGUU
786 picture button
mdo-miR-1 miR-1 Monodelphis domestica
UGGAAUGUAAAGAAGUAUGUA
617 picture button
mdo-miR-7 miR-7 Monodelphis domestica
UGGAAGACUAGUGAUUUUGUUG
790 picture button
mdo-miR-9* miR-9* Monodelphis domestica
UAAAGCUAGAUAACCGAAAGU
719 picture button
mdo-miR-9 miR-9 Monodelphis domestica
UCUUUGGUUAUCUAGCUGUAUGA
647 picture button
mdo-miR-10b miR-10 Monodelphis domestica
AUACCCUGUAGAACCGAAUUUGU
957 picture button
mdo-miR-10a miR-10 Monodelphis domestica
UACCCUGUAGAUCCGAAUUUGUG
935 picture button
mdo-miR-15a miR-15 Monodelphis domestica
UAGCAGCACAUAAUGGUUUGUU
998 picture button
mdo-miR-16 miR-16 Monodelphis domestica
UAGCAGCACGUAAAUAUUGGCG
962 picture button
mdo-miR-17-5p miR-17 Monodelphis domestica
CAAAGUGCUUACAGUGCAGGUAGU
1031 picture button
mdo-miR-17-3p miR-17 Monodelphis domestica
ACUGCAGUGAAGGCACUUGUA
901 picture button
mdo-miR-18 miR-18 Monodelphis domestica
UAAGGUGCAUCUAGUGCAGAUA
893 picture button
mdo-miR-19b miR-19 Monodelphis domestica
UGUGCAAAUCCAUGCAAAACUGA
889 picture button
mdo-miR-19a miR-19 Monodelphis domestica
UGUGCAAAUCUAUGCAAAACUGA
885 picture button
mdo-miR-20 miR-20 Monodelphis domestica
UAAAGUGCUUAUAGUGCAGGUAG
940 picture button
mdo-miR-21 miR-21 Monodelphis domestica
UAGCUUAUCAGACUGAUGUUGA
799 picture button
mdo-miR-22 miR-22 Monodelphis domestica
AAGCUGCCAGUUGAAGAACUGC
897 picture button
mdo-miR-23a miR-23 Monodelphis domestica
AUCACAUUGCCAGGGAUUUC
866 picture button
mdo-miR-23b miR-23 Monodelphis domestica
AUCACAUUGCCAGGGAUUACC
863 picture button
mdo-miR-24 miR-24 Monodelphis domestica
UGGCUCAGUUCAGCAG
804 picture button
mdo-miR-25 miR-25 Monodelphis domestica
CAUUGCACUUGUCUCGGUCUGA
891 picture button
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
857 picture button
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
845 picture button
mdo-miR-27b miR-27 Monodelphis domestica
UUCACAGUGGCUAAGUUCUGC
964 picture button
mdo-miR-27a miR-27 Monodelphis domestica
UUCACAGUGGCUAAGUUCCGC
943 picture button
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
815 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
744 picture button
mdo-miR-29a miR-29 Monodelphis domestica
UAGCACCAUUUGAAAUCGGU
1048 picture button
mdo-miR-29b miR-29 Monodelphis domestica
UAGCACCAUUUGAAAUCAGU
1002 picture button
mdo-miR-30a miR-30 Monodelphis domestica
UGUAAACAUCCUCGACUGGAAG
930 picture button
mdo-miR-31 miR-31 Monodelphis domestica
GGAGGCAAGAUGUUGGCAUAGCUG
673 picture button
mdo-miR-32 miR-32 Monodelphis domestica
UAUUGCACAUUACUAAGUUGC
835 picture button
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
825 picture button
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
821 picture button
mdo-miR-34a miR-34 Monodelphis domestica
UGGCAGUGUCUUAGCUGGUUGUU
941 picture button
mdo-miR-92 miR-92 Monodelphis domestica
UAUUGCACUUGUCCCGGCCUG
912 picture button
mdo-miR-93 miR-93 Monodelphis domestica
AAAGUGCUGUUCGUGCAGGUAG
900 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
757 picture button
mdo-miR-96 miR-96 Monodelphis domestica
UUUGGCACUAGCACAUUUUUGCU
878 picture button
bta-miR-98 miR-98 Bos taurus
UGAGGUAGUAAGUUGUAUUGUU
663 picture button
bta-miR-99b miR-99 Bos taurus
CACCCGUAGAACCGACCUUGCG
793 picture button
bta-miR-99a miR-99 Bos taurus
AACCCGUAGAUCCGAUCUUGU
830 picture button
mdo-miR-100 miR-100 Monodelphis domestica
AACCCGUAGAUCCGAACUUGU
771 picture button
mdo-miR-101 miR-101 Monodelphis domestica
UACAGUACUGUGAUAACUGAAG
984 picture button
mdo-miR-103 miR-103 Monodelphis domestica
AGCAGCAUUGUACAGGGCUAUGA
921 picture button
hsa-miR-105 miR-105 Homo sapiens
UCAAAUGCUCAGACUCCUGUGGU
831 picture button
bta-miR-106 miR-106 Bos taurus
AAAAGUGCUUACAGUGCAGGUA
895 picture button
mdo-miR-107 miR-107 Monodelphis domestica
AGCAGCAUUGUACAGGGCUAUCA
930 picture button
mdo-miR-122 miR-122 Monodelphis domestica
UGGAGUGUGACAAUGGUGUUUGUGU
696 picture button
mdo-miR-124a miR-124 Monodelphis domestica
UUAAGGCACGCGGUGAAUGCCA
757 picture button
mdo-miR-125b miR-125 Monodelphis domestica
UCCCUGAGACCCUAACUUGUGA
989 picture button
bta-miR-126 miR-126 Bos taurus
CGUACCGUGAGUAAUAAUGCG
821 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
688 picture button
mdo-miR-128b miR-128 Monodelphis domestica
UCACAGUGAACCGGUCUCUUU
891 picture button
mdo-miR-129 miR-129 Monodelphis domestica
CUUUUUGCGGUCUGGGCUUGCU
681 picture button
mdo-miR-130a miR-130 Monodelphis domestica
CAGUGCAAUGUAAAAAGGGCAU
939 picture button
mdo-miR-132 miR-132 Monodelphis domestica
UAACAGUCUACAGCCAUGGUCG
956 picture button
mdo-miR-133a miR-133 Monodelphis domestica
UUGGUCCCCUUCAACCAGCUGU
798 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
792 picture button
mdo-miR-135a miR-135 Monodelphis domestica
UAUGGCUUUUUAUUCCUAUGUGA
861 picture button
mdo-miR-135b miR-135 Monodelphis domestica
UAUGGCUUUUCAUUCCUAUGUG
816 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
608 picture button
mdo-miR-137 miR-137 Monodelphis domestica
UAUUGCUUAAGAAUACGCGUAG
728 picture button
mdo-miR-138 miR-138 Monodelphis domestica
AGCUGGUGUUGUGAAUC
786 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
855 picture button
bta-miR-140 miR-140 Bos taurus
UACCACAGGGUAGAACCACGGA
889 picture button
mdo-miR-141 miR-141 Monodelphis domestica
UAACACUGUCUGGUAAAGAUGC
952 picture button
mdo-miR-142 miR-142 Monodelphis domestica
UGUAGUGUUUCCUACUUUAUGGA
728 picture button
mdo-miR-143 miR-143 Monodelphis domestica
UGAGAUGAAGCACUGUAGCUCG
599 picture button
mdo-miR-144 miR-144 Monodelphis domestica
UACAGUAUAGAUGAUGUACUGG
859 picture button
mdo-miR-145 miR-145 Monodelphis domestica
GUCCAGUUUUCCCAGGAAUCCCU
741 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
858 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
895 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
841 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
853 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
818 picture button
bta-miR-148b miR-148 Bos taurus
UCAGUGCAUCACAGAACUUUGU
932 picture button
bta-miR-148a miR-148 Bos taurus
UCAGUGCACUACAGAACUUUGU
979 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
677 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
805 picture button
bta-miR-151 miR-151 Bos taurus
CUAGACUGAAGCUCCUUGAGG
754 picture button
mdo-miR-152 miR-152 Monodelphis domestica
UCAGUGCAUGACAGAACUUGGG
943 picture button
hsa-miR-153 miR-153 Homo sapiens
UUGCAUAGUCACAAAAGUGAUC
820 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
586 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
788 picture button
mdo-miR-181b miR-181 Monodelphis domestica
AACAUUCAUUGCUGUCGGUGGG
1045 picture button
mdo-miR-181a miR-181 Monodelphis domestica
AACAUUCAACGCUGUCGGUGAGU
978 picture button
mdo-miR-182 miR-182 Monodelphis domestica
UUUGGCAAUGGUAGAACUCACA
869 picture button
mdo-miR-183 miR-183 Monodelphis domestica
UAUGGCACUGGUAGAAUUCACUG
899 picture button
mdo-miR-184 miR-184 Monodelphis domestica
UGGACGGAGAACUGAUAAGGGU
783 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
436 picture button
mdo-miR-186 miR-186 Monodelphis domestica
CAAAGAAUUCUCCUUUUGGGCUU
559 picture button
mdo-miR-187 miR-187 Monodelphis domestica
UCGUGUCUUGUGUUGCAGCC
657 picture button
hsa-miR-188-5p miR-188 Homo sapiens
CAUCCCUUGCAUGGUGGAGGG
736 picture button
hsa-miR-188-3p miR-188 Homo sapiens
CUCCCACAUGCAGGGUUUGCA
1019 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer