spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 7 of 7
<< prev 1 2 3 4 5 6 7

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-768-5p miR-768 Homo sapiens
GUUGGAGGAUGAAAGUACGGAGUGAU
955 picture button
hsa-miR-769-5p miR-769 Homo sapiens
UGAGACCUCUGGGUUCUGAGCU
1036 picture button
hsa-miR-769-3p miR-769 Homo sapiens
CUGGGAUCUCCGGGGUCUUGGUU
1103 picture button
hsa-miR-770-5p miR-770 Homo sapiens
UCCAGUACCACGUGUCAGGGCCA
908 picture button
hsa-miR-801 miR-801 Homo sapiens
GAUUGCUCUGCGUGCGGAAUCGAC
880 picture button
hsa-miR-802 miR-802 Homo sapiens
CAGUAACAAAGAUUCAUCCUUGU
933 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
799 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
773 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
866 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
918 picture button
hsa-miR-873 miR-873 Homo sapiens
GCAGGAACUUGUGAGUCUCCU
1005 picture button
hsa-miR-874 miR-874 Homo sapiens
CUGCCCUGGCCCGAGGGACCGA
957 picture button
hsa-miR-875-5p miR-875 Homo sapiens
UAUACCUCAGUUUUAUCAGGUG
982 picture button
hsa-miR-875-3p miR-875 Homo sapiens
CCUGGAAACACUGAGGUUGUG
980 picture button
hsa-miR-876-5p miR-876 Homo sapiens
UGGAUUUCUUUGUGAAUCACCA
940 picture button
hsa-miR-876-3p miR-876 Homo sapiens
UGGUGGUUUACAAAGUAAUUCA
993 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
821 picture button
mmu-miR-878-5p miR-878 Mus musculus
UAUCUAGUUGGAUGUCAAGACA
966 picture button
mmu-miR-878-3p miR-878 Mus musculus
GCAUGACACCACACUGGGUAGA
1048 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
817 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
764 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
839 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
713 picture button
mmu-miR-883b-5p miR-883 Mus musculus
UACUGAGAAUGGGUAGCAGUCA
1066 picture button
mmu-miR-883a-3p miR-883 Mus musculus
UAACUGCAACAGCUCUCAGUAU
1124 picture button
mmu-miR-883b-3p miR-883 Mus musculus
UAACUGCAACAUCUCUCAGUAU
1055 picture button
mmu-miR-883a-5p miR-883 Mus musculus
UGCUGAGAGAAGUAGCAGUUAC
1040 picture button
hsa-miR-885-5p miR-885 Homo sapiens
UCCAUUACACUACCCUGCCUCU
985 picture button
hsa-miR-885-3p miR-885 Homo sapiens
AGGCAGCGGGGUGUAGUGGAUA
1005 picture button
hsa-miR-886-3p miR-886 Homo sapiens
CGCGGGUGCUUACUGACCCUU
1009 picture button
hsa-miR-886-5p miR-886 Homo sapiens
CGGGUCGGAGUUAGCUCAAGCGG
1046 picture button
hsa-miR-887 miR-887 Homo sapiens
GUGAACGGGCGCCAUCCCGAGG
946 picture button
hsa-miR-888 miR-888 Homo sapiens
UACUCAAAAAGCUGUCAGUCA
922 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
834 picture button
hsa-miR-890 miR-890 Homo sapiens
UACUUGGAAAGGCAUCAGUUG
955 picture button
hsa-miR-891b miR-891 Homo sapiens
UGCAACUUACCUGAGUCAUUGA
987 picture button
hsa-miR-891a miR-891 Homo sapiens
UGCAACGAACCUGAGCCACUGA
1090 picture button
hsa-miR-892a miR-892 Homo sapiens
CACUGUGUCCUUUCUGCGUAG
944 picture button
hsa-miR-892b miR-892 Homo sapiens
CACUGGCUCCUUUCUGGGUAGA
1084 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
879 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
821 picture button
hsa-miR-922 miR-922 Homo sapiens
GCAGCAGAGAAUAGGACUACGUC
919 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
871 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
896 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
852 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
861 picture button
hsa-miR-935 miR-935 Homo sapiens
CCAGUUACCGCUUCCGCUACCGC
841 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
882 picture button
hsa-miR-937 miR-937 Homo sapiens
AUCCGCGCUCUGACUCUCUGCC
861 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
929 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
884 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
723 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
776 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
687 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
942 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
691 picture button

Page 7 of 7
<< prev 1 2 3 4 5 6 7

spacer
spacer