spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
1051 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
1007 picture button
hsa-miR-650 miR-650 Homo sapiens
AGGAGGCAGCGCUCUCAGGAC
937 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
783 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
1012 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
783 picture button
hsa-miR-654-5p miR-654 Homo sapiens
UGGUGGGCCGCAGAACAUGUGC
899 picture button
hsa-miR-654-3p miR-654 Homo sapiens
UAUGUCUGCUGACCAUCACCUU
925 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
813 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
695 picture button
hsa-miR-657 miR-657 Homo sapiens
GGCAGGUUCUCACCCUCUCUAGG
901 picture button
hsa-miR-658 miR-658 Homo sapiens
GGCGGAGGGAAGUAGGUCCGUUGGU
808 picture button
hsa-miR-659 miR-659 Homo sapiens
CUUGGUUCAGGGAGGGUCCCCA
937 picture button
hsa-miR-660 miR-660 Homo sapiens
UACCCAUUGCAUAUCGGAGUUG
935 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
643 picture button
hsa-miR-662 miR-662 Homo sapiens
UCCCACGUUGUGGCCCAGCAG
922 picture button
hsa-miR-663 miR-663 Homo sapiens
AGGCGGGGCGCCGCGGGACCGC
825 picture button
rno-miR-664 miR-664 Rattus norvegicus
UAUUCAUUUACUCCCCAGCCUA
906 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
899 picture button
mmu-miR-666-3p miR-666 Mus musculus
GGCUGCAGCGUGAUCGCCUGCU
907 picture button
mmu-miR-666-5p miR-666 Mus musculus
AGCGGGCACAGCUGUGAGAGCC
1062 picture button
mmu-miR-667 miR-667 Mus musculus
UGACACCUGCCACCCAGCCCAAG
909 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
813 picture button
mmu-miR-669b miR-669 Mus musculus
AGUUUUGUGUGCAUGUGCAUGU
990 picture button
mmu-miR-669a miR-669 Mus musculus
AGUUGUGUGUGCAUGUUCAUGU
973 picture button
mmu-miR-669c miR-669 Mus musculus
AUAGUUGUGUGUGGAUGUGUGU
1026 picture button
mmu-miR-670 miR-670 Mus musculus
AUCCCUGAGUGUAUGUGGUGAA
990 picture button
hsa-miR-671-3p miR-671 Homo sapiens
UCCGGUUCUCAGGGCUCCACC
986 picture button
hsa-miR-671-5p miR-671 Homo sapiens
AGGAAGCCCUGGAGGGGCUGGAG
1138 picture button
hsa-miR-672 miR-672 Homo sapiens
UGAGGUUGGUGUACUGUGUGUGA
709 picture button
mmu-miR-673-5p miR-673 Mus musculus
CUCACAGCUCUGGUCCUUGGAG
1129 picture button
mmu-miR-673-3p miR-673 Mus musculus
UCCGGGGCUGAGUUCUGUGCACC
1032 picture button
hsa-miR-674 miR-674 Homo sapiens
GCACUGAGAUGGGAGUGGUGUA
998 picture button
hsa-miR-675 miR-675 Homo sapiens
UGGUGCGGAGAGGGCCCACAGUG
862 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
834 picture button
mmu-miR-677 miR-677 Mus musculus
UUCAGUGAUGAUUAGCUUCUGA
980 picture button
mmu-miR-678 miR-678 Mus musculus
GUCUCGGUGCAAGGACUGGAGG
837 picture button
mmu-miR-679 miR-679 Mus musculus
GGACUGUGAGGUGACUCUUGGU
938 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
918 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
614 picture button
mmu-miR-682 miR-682 Mus musculus
CUGCAGUCACAGUGAAGUCUG
1023 picture button
mmu-miR-683 miR-683 Mus musculus
CCUGCUGUAAGCUGUGUCCUC
940 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
842 picture button
mmu-miR-685 miR-685 Mus musculus
UCAAUGGCUGAGGUGAGGCAC
985 picture button
mmu-miR-686 miR-686 Mus musculus
AUUGCUUCCCAGACGGUGAAGA
911 picture button
mmu-miR-687 miR-687 Mus musculus
CUAUCCUGGAAUGCAGCAAUGA
835 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
803 picture button
mmu-miR-689 miR-689 Mus musculus
CGUCCCCGCUCGGCGGGGUCC
844 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
873 picture button
mmu-miR-691 miR-691 Mus musculus
AUUCCUGAAGAGAGGCAGAAAA
915 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
702 picture button
mmu-miR-693-3p miR-693 Mus musculus
GCAGCUUUCAGAUGUGGCUGUAA
917 picture button
mmu-miR-693-5p miR-693 Mus musculus
CAGCCACAUCCGAAAGUUUUC
1154 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
579 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
878 picture button
mmu-miR-696 miR-696 Mus musculus
GCGUGUGCUUGCUGUGGG
936 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
991 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
824 picture button
mmu-miR-699 miR-699 Mus musculus
AGGCAGUGCGACCUGGCUCG
959 picture button
mmu-miR-700 miR-700 Mus musculus
CACGCGGGAACCGAGUCCACC
999 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
756 picture button
mmu-miR-702 miR-702 Mus musculus
UGCCCACCCUUUACCCCGCUC
985 picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
1016 picture button
mmu-miR-704 miR-704 Mus musculus
AGACAUGUGCUCUGCUCCUAG
930 picture button
mmu-miR-705 miR-705 Mus musculus
GGUGGGAGGUGGGGUGGGCA
818 picture button
mmu-miR-706 miR-706 Mus musculus
AGAGAAACCCUGUCUCAAAAAA
810 picture button
mmu-miR-707 miR-707 Mus musculus
CAGUCAUGCCGCUUGCCUACG
955 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
860 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
797 picture button
mmu-miR-710 miR-710 Mus musculus
CCAAGUCUUGGGGAGAGUUGAG
1015 picture button
mmu-miR-711 miR-711 Mus musculus
GGGACCCGGGGAGAGAUGUAAG
814 picture button
mmu-miR-712 miR-712 Mus musculus
CUCCUUCACCCGGGCGGUACC
868 picture button
mmu-miR-713 miR-713 Mus musculus
UGCACUGAAGGCACACAGC
978 picture button
mmu-miR-714 miR-714 Mus musculus
CGACGAGGGCCGGUCGGUCGC
904 picture button
mmu-miR-715 miR-715 Mus musculus
CUCCGUGCACACCCCCGCGUG
930 picture button
mmu-miR-717 miR-717 Mus musculus
CUCAGACAGAGAUACCUUCUCU
946 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
649 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
887 picture button
mmu-miR-720 miR-720 Mus musculus
AUCUCGCUGGGGCCUCCA
845 picture button
mmu-miR-721 miR-721 Mus musculus
CAGUGCAAUUAAAAGGGGGAA
971 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
752 picture button
mmu-miR-742 miR-742 Mus musculus
GAAAGCCACCAUGCUGGGUAAA
955 picture button
mmu-miR-743b-3p miR-743 Mus musculus
GAAAGACAUCAUGCUGAAUAGA
953 picture button
mmu-miR-743a miR-743 Mus musculus
GAAAGACACCAAGCUGAGUAGA
943 picture button
mmu-miR-743b-5p miR-743 Mus musculus
UGUUCAGACUGGUGUCCAUCA
998 picture button
hsa-miR-744 miR-744 Homo sapiens
UGCGGGGCUAGGGCUAACAGCA
961 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
939 picture button
hsa-miR-758 miR-758 Homo sapiens
UUUGUGACCUGGUCCACUAACC
923 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
779 picture button
hsa-miR-760 miR-760 Homo sapiens
CGGCUCUGGGUCUGUGGGGA
891 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
812 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
806 picture button
mmu-miR-763 miR-763 Mus musculus
CCAGCUGGGAAGAACCAGUGGC
979 picture button
mmu-miR-764-5p miR-764 Mus musculus
GGUGCUCACAUGUCCUCCU
1019 picture button
mmu-miR-764-3p miR-764 Mus musculus
AGGAGGCCAUAGUGGCAACUGU
864 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
769 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
695 picture button
hsa-miR-767-3p miR-767 Homo sapiens
UCUGCUCAUACCCCAUGGUUUCU
1159 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
930 picture button
hsa-miR-768-3p miR-768 Homo sapiens
UCACAAUGCUGACACUCAAACUGCUGAC
1051 picture button

Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer