spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-554 miR-554 Homo sapiens
GCUAGUCCUGACUCAGCCAGU
865 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
801 picture button
hsa-miR-556-3p miR-556 Homo sapiens
AUAUUACCAUUAGCUCAUCUUU
1048 picture button
hsa-miR-556-5p miR-556 Homo sapiens
GAUGAGCUCAUUGUAAUAUGAG
991 picture button
hsa-miR-557 miR-557 Homo sapiens
GUUUGCACGGGUGGGCCUUGUCU
1042 picture button
hsa-miR-558 miR-558 Homo sapiens
UGAGCUGCUGUACCAAAAU
837 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
549 picture button
hsa-miR-560 miR-560 Homo sapiens
GCGUGCGCCGGCCGGCCGCC
953 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
729 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
875 picture button
hsa-miR-563 miR-563 Homo sapiens
AGGUUGACAUACGUUUCCC
1009 picture button
hsa-miR-564 miR-564 Homo sapiens
AGGCACGGUGUCAGCAGGC
940 picture button
hsa-miR-565 miR-565 Homo sapiens
GGCUGGCUCGCGAUGUCUGUUU
850 picture button
hsa-miR-566 miR-566 Homo sapiens
GGGCGCCUGUGAUCCCAAC
1140 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
826 picture button
hsa-miR-568 miR-568 Homo sapiens
AUGUAUAAAUGUAUACACAC
757 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
764 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
706 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
915 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
780 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
865 picture button
hsa-miR-574-3p miR-574 Homo sapiens
CACGCUCAUGCACACACCCACA
1114 picture button
hsa-miR-574-5p miR-574 Homo sapiens
UGAGUGUGUGUGUGUGAGUGUGU
1111 picture button
hsa-miR-575 miR-575 Homo sapiens
GAGCCAGUUGGACAGGAGC
1025 picture button
hsa-miR-576-5p miR-576 Homo sapiens
AUUCUAAUUUCUCCACGUCUUU
985 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
943 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
515 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
824 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
832 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
595 picture button
hsa-miR-581 miR-581 Homo sapiens
UCUUGUGUUCUCUAGAUCAGU
884 picture button
hsa-miR-582-3p miR-582 Homo sapiens
UAACUGGUUGAACAACUGAACC
1079 picture button
hsa-miR-582-5p miR-582 Homo sapiens
UUACAGUUGUUCAACCAGUUACU
989 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
779 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
831 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
919 picture button
hsa-miR-586 miR-586 Homo sapiens
UAUGCAUUGUAUUUUUAGGUCC
916 picture button
hsa-miR-587 miR-587 Homo sapiens
UUUCCAUAGGUGAUGAGUCAC
998 picture button
hsa-miR-588 miR-588 Homo sapiens
UUGGCCACAAUGGGUUAGAAC
856 picture button
hsa-miR-589 miR-589 Homo sapiens
UGAGAACCACGUCUGCUCUGAG
1035 picture button
hsa-miR-590-5p miR-590 Homo sapiens
GAGCUUAUUCAUAAAAGUGCAG
1094 picture button
hsa-miR-590-3p miR-590 Homo sapiens
UAAUUUUAUGUAUAAGCUAGU
841 picture button
hsa-miR-591 miR-591 Homo sapiens
AGACCAUGGGUUCUCAUUGU
979 picture button
hsa-miR-592 miR-592 Homo sapiens
UUGUGUCAAUAUGCGAUGAUGU
873 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
677 picture button
hsa-miR-595 miR-595 Homo sapiens
GAAGUGUGCCGUGGUGUGUCU
924 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
846 picture button
hsa-miR-597 miR-597 Homo sapiens
UGUGUCACUCGAUGACCACUGU
953 picture button
hsa-miR-598 miR-598 Homo sapiens
UACGUCAUCGUUGUCAUCGUCA
975 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
833 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
760 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
857 picture button
hsa-miR-602 miR-602 Homo sapiens
GACACGGGCGACAGCUGCGGCCC
1003 picture button
hsa-miR-603 miR-603 Homo sapiens
CACACACUGCAAUUACUUUUGC
969 picture button
hsa-miR-604 miR-604 Homo sapiens
AGGCUGCGGAAUUCAGGAC
922 picture button
hsa-miR-605 miR-605 Homo sapiens
UAAAUCCCAUGGUGCCUUCUCCU
1032 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
833 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
809 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
915 picture button
hsa-miR-609 miR-609 Homo sapiens
AGGGUGUUUCUCUCAUCUCU
954 picture button
hsa-miR-610 miR-610 Homo sapiens
UGAGCUAAAUGUGUGCUGGGA
918 picture button
hsa-miR-611 miR-611 Homo sapiens
GCGAGGACCCCUCGGGGUCUGAC
916 picture button
hsa-miR-612 miR-612 Homo sapiens
GCUGGGCAGGGCUUCUGAGCUCCUU
872 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
904 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
793 picture button
hsa-miR-615-5p miR-615 Homo sapiens
GGGGGUCCCCGGUGCUCGGAUC
1041 picture button
hsa-miR-615-3p miR-615 Homo sapiens
UCCGAGCCUGGGUCUCCCUCUU
1020 picture button
hsa-miR-616 miR-616 Homo sapiens
AGUCAUUGGAGGGUUUGAGCAG
899 picture button
hsa-miR-617 miR-617 Homo sapiens
AGACUUCCCAUUUGAAGGUGGC
897 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
967 picture button
hsa-miR-619 miR-619 Homo sapiens
GACCUGGACAUGUUUGUGCCCAGU
922 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
814 picture button
hsa-miR-621 miR-621 Homo sapiens
GGCUAGCAACAGCGCUUACCU
958 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
861 picture button
hsa-miR-623 miR-623 Homo sapiens
AUCCCUUGCAGGGGCUGUUGGGU
967 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
695 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
718 picture button
hsa-miR-626 miR-626 Homo sapiens
AGCUGUCUGAAAAUGUCUU
931 picture button
hsa-miR-627 miR-627 Homo sapiens
GUGAGUCUCUAAGAAAAGAGGA
975 picture button
hsa-miR-628-3p miR-628 Homo sapiens
UCUAGUAAGAGUGGCAGUCGA
976 picture button
hsa-miR-628-5p miR-628 Homo sapiens
AUGCUGACAUAUUUACUAGAGG
1155 picture button
hsa-miR-629 miR-629 Homo sapiens
UGGGUUUACGUUGGGAGAACU
953 picture button
hsa-miR-630 miR-630 Homo sapiens
AGUAUUCUGUACCAGGGAAGGU
829 picture button
hsa-miR-631 miR-631 Homo sapiens
AGACCUGGCCCAGACCUCAGC
918 picture button
hsa-miR-632 miR-632 Homo sapiens
GUGUCUGCUUCCUGUGGGA
956 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
684 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
933 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
805 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
779 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
807 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
739 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
756 picture button
hsa-miR-640 miR-640 Homo sapiens
AUGAUCCAGGAACCUGCCUCU
1011 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
822 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
785 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
900 picture button
hsa-miR-644 miR-644 Homo sapiens
AGUGUGGCUUUCUUAGAGC
1029 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
682 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
1000 picture button
hsa-miR-647 miR-647 Homo sapiens
GUGGCUGCACUCACUUCCUUC
949 picture button

Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer