spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-490-5p miR-490 Homo sapiens
CCAUGGAUCUCCAGGUGGGU
969 picture button
hsa-miR-491-3p miR-491 Homo sapiens
CUUAUGCAAGAUUCCCUUCUAC
962 picture button
hsa-miR-491-5p miR-491 Homo sapiens
AGUGGGGAACCCUUCCAUGAGG
917 picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
897 picture button
hsa-miR-493 miR-493 Homo sapiens
UGAAGGUCUACUGUGUGCCAGG
954 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
742 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
1005 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
741 picture button
hsa-miR-497 miR-497 Homo sapiens
CAGCAGCACACUGUGGUUUGU
1092 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
966 picture button
hsa-miR-499-5p miR-499 Homo sapiens
UUAAGACUUGCAGUGAUGUUU
962 picture button
hsa-miR-499-3p miR-499 Homo sapiens
AACAUCACAGCAAGUCUGUGCU
971 picture button
hsa-miR-500 miR-500 Homo sapiens
UAAUCCUUGCUACCUGGGUGAGA
861 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
953 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
1056 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
1051 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
1015 picture button
hsa-miR-503 miR-503 Homo sapiens
UAGCAGCGGGAACAGUUCUGCAG
969 picture button
hsa-miR-504 miR-504 Homo sapiens
AGACCCUGGUCUGCACUCUAUC
840 picture button
hsa-miR-505 miR-505 Homo sapiens
CGUCAACACUUGCUGGUUUCCU
951 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
1038 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
993 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
760 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
869 picture button
hsa-miR-509-3p miR-509 Homo sapiens
UGAUUGGUACGUCUGUGGGUAG
1012 picture button
hsa-miR-509-3-5p miR-509 Homo sapiens
UACUGCAGACGUGGCAAUCAUG
1001 picture button
hsa-miR-509-5p miR-509 Homo sapiens
UACUGCAGACAGUGGCAAUCA
924 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
988 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
821 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
992 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
984 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
874 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
1012 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
990 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
1097 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
1031 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
1012 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
1027 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
1059 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
998 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
1049 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
942 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
1120 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
1235 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
1270 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
1236 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
1129 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1269 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
1227 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
1287 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1241 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1070 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1198 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
959 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1224 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1007 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1142 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
1018 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1046 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1311 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1079 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
1205 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
951 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1044 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1057 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
959 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
841 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
940 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
1051 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
885 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
1025 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
1094 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
884 picture button
hsa-miR-532-3p miR-532 Homo sapiens
CCUCCCACACCCAAGGCUUGCA
920 picture button
hsa-miR-532-5p miR-532 Homo sapiens
CAUGCCUUGAGUGUAGGACCGU
1021 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
673 picture button
mmu-miR-540-3p miR-540 Mus musculus
AGGUCAGAGGUCGAUCCUGG
1148 picture button
mmu-miR-540-5p miR-540 Mus musculus
CAAGGGUCACCCUCUGACUCUGU
1039 picture button
hsa-miR-541 miR-541 Homo sapiens
UGGUGGGCACAGAAUCUGGACU
868 picture button
hsa-miR-542-3p miR-542 Homo sapiens
UGUGACAGAUUGAUAACUGAAA
975 picture button
hsa-miR-542-5p miR-542 Homo sapiens
UCGGGGAUCAUCAUGUCACGAGA
962 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
1072 picture button
hsa-miR-544 miR-544 Homo sapiens
AUUCUGCAUUUUUAGCAAGUUC
941 picture button
hsa-miR-545 miR-545 Homo sapiens
UCAGCAAACAUUUAUUGUGUGC
993 picture button
mmu-miR-546 miR-546 Mus musculus
AUGGUGGCACGGAGUC
847 picture button
mmu-miR-547 miR-547 Mus musculus
CUUGGUACAUCUUUGAGUGAG
933 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
1280 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
982 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
1253 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
996 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
1329 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
999 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
1227 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
936 picture button
hsa-miR-549 miR-549 Homo sapiens
UGACAACUAUGGAUGAGCUCU
989 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
871 picture button
hsa-miR-551b miR-551 Homo sapiens
GCGACCCAUACUUGGUUUCAG
839 picture button
hsa-miR-551a miR-551 Homo sapiens
GCGACCCACUCUUGGUUUCCA
836 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
843 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
955 picture button

Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer