spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-186 miR-186 Homo sapiens
CAAAGAAUUCUCCUUUUGGGCU
716 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
905 picture button
mml-miR-188 miR-188 Macaca mulatta
CAUCCCUUGCAUGGUGGAGGGU
990 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
1014 picture button
mml-miR-190 miR-190 Macaca mulatta
UGAUAUGUUUGAUAUAUUAGGU
719 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
869 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
913 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
930 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
892 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
950 picture button
mml-miR-194 miR-194 Macaca mulatta
UGUAACAGCAACUCCAUGUGGA
929 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
953 picture button
mml-miR-196 miR-196 Macaca mulatta
UAGGUAGUUUCAUGUUGUUGG
1010 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
898 picture button
mml-miR-198 miR-198 Macaca mulatta
GGUCCAGAGGGGAAAUAGG
979 picture button
mml-miR-199a miR-199 Macaca mulatta
CCCAGUGUUCAGACUACCUGUUC
1128 picture button
mml-miR-200c miR-200 Macaca mulatta
AAUACUGCCGGGUAAUGAUGGA
1136 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
905 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
947 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
771 picture button
hsa-miR-204 miR-204 Homo sapiens
UUCCCUUUGUCAUCCUAUGCCU
802 picture button
hsa-miR-205 miR-205 Homo sapiens
UCCUUCAUUCCACCGGAGUCUG
941 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
827 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
572 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
869 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
805 picture button
hsa-miR-210 miR-210 Homo sapiens
CUGUGCGUGUGACAGCGGCUGA
912 picture button
mml-miR-211 miR-211 Macaca mulatta
UUCCCUUUGUCAUCCUUUGCCU
722 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
1143 picture button
mml-miR-214 miR-214 Macaca mulatta
ACAGCAGGCACAGACAGGCAG
1040 picture button
mml-miR-215 miR-215 Macaca mulatta
AUGACCUAUGAAUUGACAGAC
1022 picture button
hsa-miR-216b miR-216 Homo sapiens
AAAUCUCUGCAGGCAAAUGUGA
1044 picture button
hsa-miR-216a miR-216 Homo sapiens
UAAUCUCAGCUGGCAACUGUGA
881 picture button
hsa-miR-217 miR-217 Homo sapiens
UACUGCAUCAGGAACUGAUUGGA
913 picture button
mml-miR-218 miR-218 Macaca mulatta
UUGUGCUUGAUCUAACCAUGU
956 picture button
mml-miR-219 miR-219 Macaca mulatta
UGAUUGUCCAAACGCAAUUCU
1023 picture button
mml-miR-220 miR-220 Macaca mulatta
CCACCACCAUGUCUGACACUUU
1236 picture button
mml-miR-221 miR-221 Macaca mulatta
AGCUACAUUGUCUGCUGGGUUUC
1008 picture button
hsa-miR-222 miR-222 Homo sapiens
AGCUACAUCUGGCUACUGGGU
992 picture button
mml-miR-223 miR-223 Macaca mulatta
UGUCAGUUUGUCAAAUACCCC
952 picture button
mml-miR-224 miR-224 Macaca mulatta
CAAGUCACUAGUGGUUCCGUUUA
1007 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
1088 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
1098 picture button
mmu-miR-291b-5p miR-291 Mus musculus
GAUCAAAGUGGAGGCCCUCUCC
1103 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
994 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
1185 picture button
mmu-miR-291a-5p miR-291 Mus musculus
CAUCAAAGUGGAGGCCCUCUCU
1099 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
1196 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
1104 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
819 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
873 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
694 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
1046 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
1084 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
934 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
872 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
971 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
957 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
865 picture button
hsa-miR-301a miR-301 Homo sapiens
CAGUGCAAUAGUAUUGUCAAAGC
1063 picture button
hsa-miR-301b miR-301 Homo sapiens
CAGUGCAAUGAUAUUGUCAAAGC
1025 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
791 picture button
hsa-miR-302a miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUGGUGA
855 picture button
hsa-miR-302c miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUCAGUGG
897 picture button
hsa-miR-302b miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUAGUAG
911 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
1000 picture button
mmu-miR-322 miR-322 Mus musculus
CAGCAGCAAUUCAUGUUUUGGA
1039 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
1071 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
985 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
1135 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
1118 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
944 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
836 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
874 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
885 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
924 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
913 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
996 picture button
hsa-miR-331-5p miR-331 Homo sapiens
CUAGGUAUGGUCCCAGGGAUCC
830 picture button
hsa-miR-331-3p miR-331 Homo sapiens
GCCCCUGGGCCUAUCCUAGAA
999 picture button
rno-miR-333 miR-333 Rattus norvegicus
GUGGUGUGCUAGUUACUUUU
907 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
998 picture button
rno-miR-336 miR-336 Rattus norvegicus
UCACCCUUCCAUAUCUAGUCU
932 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
1039 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
1006 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
1101 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
1021 picture button
hsa-miR-339-5p miR-339 Homo sapiens
UCCCUGUCCUCCAGGAGCUCACG
929 picture button
hsa-miR-339-3p miR-339 Homo sapiens
UGAGCGCCUCGACGACAGAGCCG
1100 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
640 picture button
mmu-miR-341 miR-341 Mus musculus
UCGGUCGAUCGGUCGGUCGGU
870 picture button
hsa-miR-342-5p miR-342 Homo sapiens
AGGGGUGCUAUCUGUGAUUGA
964 picture button
hsa-miR-342-3p miR-342 Homo sapiens
UCUCACACAGAAAUCGCACCCGU
1133 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
757 picture button
mmu-miR-344 miR-344 Mus musculus
UGAUCUAGCCAAAGCCUGACUGU
920 picture button
hsa-miR-345 miR-345 Homo sapiens
GCUGACUCCUAGUCCAGGGCUC
1028 picture button
hsa-miR-346 miR-346 Homo sapiens
UGUCUGCCCGCAUGCCUGCCUCU
845 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
783 picture button
rno-miR-349 miR-349 Rattus norvegicus
CAGCCCUGCUGUCUUAACCUCU
933 picture button
mmu-miR-350 miR-350 Mus musculus
UUCACAAAGCCCAUACACUUUC
1057 picture button

Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer