spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
515 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
549 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
572 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
579 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
595 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
614 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
640 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
643 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
649 picture button
hsa-miR-374b miR-374 Homo sapiens
AUAUAAUACAACCUGCUAAGUG
651 picture button
hsa-miR-374a miR-374 Homo sapiens
UUAUAAUACAACCUGAUAAGUG
654 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
673 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
677 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
679 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
682 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
684 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
687 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
691 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
694 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
695 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
695 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
695 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
702 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
706 picture button
hsa-miR-672 miR-672 Homo sapiens
UGAGGUUGGUGUACUGUGUGUGA
709 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
713 picture button
hsa-miR-186 miR-186 Homo sapiens
CAAAGAAUUCUCCUUUUGGGCU
716 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
716 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
718 picture button
mml-miR-190 miR-190 Macaca mulatta
UGAUAUGUUUGAUAUAUUAGGU
719 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
719 picture button
mml-miR-211 miR-211 Macaca mulatta
UUCCCUUUGUCAUCCUUUGCCU
722 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
723 picture button
mml-miR-98 miR-98 Macaca mulatta
UGAGGUAGUAAGUUGUAUUGUU
726 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
729 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
732 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
735 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
739 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
741 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
742 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
752 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
756 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
756 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
757 picture button
hsa-miR-568 miR-568 Homo sapiens
AUGUAUAAAUGUAUACACAC
757 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
760 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
760 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
760 picture button
hsa-miR-142-5p miR-142 Homo sapiens
CAUAAAGUAGAAAGCACUACU
762 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
764 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
764 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
765 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
769 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
771 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
773 picture button
hsa-miR-380 miR-380 Homo sapiens
UAUGUAAUAUGGUCCACAUCUU
776 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
776 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
779 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
779 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
779 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
780 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
783 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
783 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
783 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
785 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
790 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
791 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
793 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
797 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
797 picture button
mml-miR-127 miR-127 Macaca mulatta
UCGGAUCCGUCUGAGCUUGGCU
799 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
799 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
801 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
801 picture button
hsa-miR-204 miR-204 Homo sapiens
UUCCCUUUGUCAUCCUAUGCCU
802 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
803 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
805 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
805 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
806 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
807 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
808 picture button
hsa-miR-658 miR-658 Homo sapiens
GGCGGAGGGAAGUAGGUCCGUUGGU
808 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
809 picture button
mmu-miR-706 miR-706 Mus musculus
AGAGAAACCCUGUCUCAAAAAA
810 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
812 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
813 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
813 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
814 picture button
mmu-miR-711 miR-711 Mus musculus
GGGACCCGGGGAGAGAUGUAAG
814 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
815 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
817 picture button
mmu-miR-705 miR-705 Mus musculus
GGUGGGAGGUGGGGUGGGCA
818 picture button
mml-miR-31 miR-31 Macaca mulatta
GGCAAGAUGCUGGCAUAGCUG
819 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
819 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
821 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
821 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
821 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
822 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
824 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
824 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer