spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
719 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
873 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
939 picture button
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
859 picture button
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
880 picture button
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
868 picture button
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
929 picture button
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
851 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
815 picture button
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
925 picture button
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
901 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
801 picture button
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
921 picture button
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
945 picture button
hsa-miR-122 miR-122 Homo sapiens
UGGAGUGUGACAAUGGUGUUUG
878 picture button
hsa-miR-126 miR-126 Homo sapiens
UCGUACCGUGAGUAAUAAUGCG
932 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
1022 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
917 picture button
hsa-miR-132 miR-132 Homo sapiens
UAACAGUCUACAGCCAUGGUCG
1140 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
983 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
830 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
990 picture button
hsa-miR-138 miR-138 Homo sapiens
AGCUGGUGUUGUGAAUCAGGCCG
1021 picture button
hsa-miR-139-3p miR-139 Homo sapiens
GGAGACGCGGCCCUGUUGGAGU
1039 picture button
hsa-miR-139-5p miR-139 Homo sapiens
UCUACAGUGCACGUGUCUCCAG
1059 picture button
hsa-miR-140-3p miR-140 Homo sapiens
UACCACAGGGUAGAACCACGG
1052 picture button
hsa-miR-140-5p miR-140 Homo sapiens
CAGUGGUUUUACCCUAUGGUAG
844 picture button
hsa-miR-142-3p miR-142 Homo sapiens
UGUAGUGUUUCCUACUUUAUGGA
984 picture button
hsa-miR-142-5p miR-142 Homo sapiens
CAUAAAGUAGAAAGCACUACU
762 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
898 picture button
hsa-miR-144 miR-144 Homo sapiens
UACAGUAUAGAUGAUGUACU
1036 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
994 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
957 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
965 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
979 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
1060 picture button
hsa-miR-148a miR-148 Homo sapiens
UCAGUGCACUACAGAACUUUGU
1023 picture button
hsa-miR-148b miR-148 Homo sapiens
UCAGUGCAUCACAGAACUUUGU
1059 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
732 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
735 picture button
hsa-miR-151-3p miR-151 Homo sapiens
CUAGACUGAAGCUCCUUGAGG
1004 picture button
hsa-miR-151-5p miR-151 Homo sapiens
UCGAGGAGCUCACAGUCUAGU
951 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
1032 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
797 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
921 picture button
hsa-miR-184 miR-184 Homo sapiens
UGGACGGAGAACUGAUAAGGGU
923 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
760 picture button
hsa-miR-186 miR-186 Homo sapiens
CAAAGAAUUCUCCUUUUGGGCU
716 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
905 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
869 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
913 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
892 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
930 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
950 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
953 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
898 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
947 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
771 picture button
hsa-miR-204 miR-204 Homo sapiens
UUCCCUUUGUCAUCCUAUGCCU
802 picture button
hsa-miR-205 miR-205 Homo sapiens
UCCUUCAUUCCACCGGAGUCUG
941 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
827 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
805 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
869 picture button
hsa-miR-210 miR-210 Homo sapiens
CUGUGCGUGUGACAGCGGCUGA
912 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
1143 picture button
hsa-miR-216a miR-216 Homo sapiens
UAAUCUCAGCUGGCAACUGUGA
881 picture button
hsa-miR-216b miR-216 Homo sapiens
AAAUCUCUGCAGGCAAAUGUGA
1044 picture button
hsa-miR-217 miR-217 Homo sapiens
UACUGCAUCAGGAACUGAUUGGA
913 picture button
hsa-miR-222 miR-222 Homo sapiens
AGCUACAUCUGGCUACUGGGU
992 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
1084 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
1046 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
934 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
872 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
971 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
957 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
865 picture button
hsa-miR-301a miR-301 Homo sapiens
CAGUGCAAUAGUAUUGUCAAAGC
1063 picture button
hsa-miR-301b miR-301 Homo sapiens
CAGUGCAAUGAUAUUGUCAAAGC
1025 picture button
hsa-miR-302a miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUGGUGA
855 picture button
hsa-miR-302b miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUUAGUAG
911 picture button
hsa-miR-302c miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUCAGUGG
897 picture button
hsa-miR-302d miR-302 Homo sapiens
UAAGUGCUUCCAUGUUUGAGUGU
791 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
1000 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
1071 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
985 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
1118 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
1135 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
944 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
836 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
885 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
924 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
996 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
913 picture button
hsa-miR-331-3p miR-331 Homo sapiens
GCCCCUGGGCCUAUCCUAGAA
999 picture button
hsa-miR-331-5p miR-331 Homo sapiens
CUAGGUAUGGUCCCAGGGAUCC
830 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
998 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
1006 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
1039 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
1101 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
1021 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer