spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
925 picture button
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
929 picture button
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
859 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
815 picture button
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
868 picture button
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
901 picture button
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
851 picture button
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
880 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
801 picture button
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
945 picture button
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
921 picture button
mml-miR-100 miR-100 Macaca mulatta
AACCCGUAGAUCCGAACUUGUG
890 picture button
mml-miR-101 miR-101 Macaca mulatta
UACAGUACUGUGAUAACUGAAG
1103 picture button
mml-miR-103 miR-103 Macaca mulatta
AGCAGCAUUGUACAGGGCUAUGA
1005 picture button
mml-miR-105 miR-105 Macaca mulatta
UCAAAUGCUCAGACUCCUGU
950 picture button
mml-miR-106b miR-106 Macaca mulatta
UAAAGUGCUGACAGUGCAGAU
1606 picture button
mml-miR-106a miR-106 Macaca mulatta
AAAAGUGCUUACAGUGCAGGUAGC
1233 picture button
mml-miR-107 miR-107 Macaca mulatta
AGCAGCAUUGUACAGGGCUAUCA
974 picture button
hsa-miR-122 miR-122 Homo sapiens
UGGAGUGUGACAAUGGUGUUUG
878 picture button
mml-miR-124a miR-124 Macaca mulatta
UUAAGGCACGCGGUGAAUGCCA
942 picture button
mml-miR-125b miR-125 Macaca mulatta
UCCCUGAGACCCUAACUUGUGA
1108 picture button
hsa-miR-126 miR-126 Homo sapiens
UCGUACCGUGAGUAAUAAUGCG
932 picture button
mml-miR-127 miR-127 Macaca mulatta
UCGGAUCCGUCUGAGCUUGGCU
799 picture button
mml-miR-128a miR-128 Macaca mulatta
UCACAGUGAACCGGUCUCUUUU
1084 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
1022 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
917 picture button
mml-miR-130a miR-130 Macaca mulatta
CAGUGCAAUGUUAAAAGGGC
1075 picture button
hsa-miR-132 miR-132 Homo sapiens
UAACAGUCUACAGCCAUGGUCG
1140 picture button
mml-miR-133a miR-133 Macaca mulatta
UUGUCCCCUUCAACCAGCUGU
933 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
983 picture button
mml-miR-135 miR-135 Macaca mulatta
UAUGGCUUUUUAUUCCUAUGUGA
994 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
830 picture button
hsa-miR-137 miR-137 Homo sapiens
UUAUUGCUUAAGAAUACGCGUAG
990 picture button
hsa-miR-138 miR-138 Homo sapiens
AGCUGGUGUUGUGAAUCAGGCCG
1021 picture button
hsa-miR-139-5p miR-139 Homo sapiens
UCUACAGUGCACGUGUCUCCAG
1059 picture button
hsa-miR-139-3p miR-139 Homo sapiens
GGAGACGCGGCCCUGUUGGAGU
1039 picture button
hsa-miR-140-5p miR-140 Homo sapiens
CAGUGGUUUUACCCUAUGGUAG
844 picture button
hsa-miR-140-3p miR-140 Homo sapiens
UACCACAGGGUAGAACCACGG
1052 picture button
mml-miR-141 miR-141 Macaca mulatta
AACACUGUCUGGUAAAGAUGG
974 picture button
hsa-miR-142-5p miR-142 Homo sapiens
CAUAAAGUAGAAAGCACUACU
762 picture button
hsa-miR-142-3p miR-142 Homo sapiens
UGUAGUGUUUCCUACUUUAUGGA
984 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
898 picture button
hsa-miR-144 miR-144 Homo sapiens
UACAGUAUAGAUGAUGUACU
1036 picture button
mml-miR-145 miR-145 Macaca mulatta
GUCCAGUUUUCCCAGGAAUCCCUU
946 picture button
hsa-miR-146b-5p miR-146 Homo sapiens
UGAGAACUGAAUUCCAUAGGCU
965 picture button
hsa-miR-146b-3p miR-146 Homo sapiens
UGCCCUGUGGACUCAGUUCUGG
957 picture button
hsa-miR-146a miR-146 Homo sapiens
UGAGAACUGAAUUCCAUGGGUU
994 picture button
hsa-miR-147b miR-147 Homo sapiens
GUGUGCGGAAAUGCUUCUGCUA
1060 picture button
hsa-miR-147 miR-147 Homo sapiens
GUGUGUGGAAAUGCUUCUGC
979 picture button
hsa-miR-148b miR-148 Homo sapiens
UCAGUGCAUCACAGAACUUUGU
1059 picture button
hsa-miR-148a miR-148 Homo sapiens
UCAGUGCACUACAGAACUUUGU
1023 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
732 picture button
mml-miR-15b miR-15 Macaca mulatta
UAGCAGCACAUCAUGGUUUACA
1073 picture button
mml-miR-15a miR-15 Macaca mulatta
UAGCAGCACAUAAUGGUUUGUG
1135 picture button
hsa-miR-150 miR-150 Homo sapiens
UCUCCCAACCCUUGUACCAGUG
735 picture button
hsa-miR-151-5p miR-151 Homo sapiens
UCGAGGAGCUCACAGUCUAGU
951 picture button
hsa-miR-151-3p miR-151 Homo sapiens
CUAGACUGAAGCUCCUUGAGG
1004 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
1032 picture button
mml-miR-153 miR-153 Macaca mulatta
UUGCAUAGUCACAAAAGUGA
1002 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
797 picture button
hsa-miR-155 miR-155 Homo sapiens
UUAAUGCUAAUCGUGAUAGGGGU
921 picture button
mml-miR-16 miR-16 Macaca mulatta
UAGCAGCACGUAAAUAUUGGCG
1040 picture button
mml-miR-17-3p miR-17 Macaca mulatta
ACUGCAGUGAAGGCACUUGU
1021 picture button
mml-miR-17-5p miR-17 Macaca mulatta
CAAAGUGCUUACAGUGCAGGUAGU
1681 picture button
mml-miR-18 miR-18 Macaca mulatta
UAAGGUGCAUCUAGUGCAGAUA
869 picture button
mml-miR-181c miR-181 Macaca mulatta
AACAUUCAACCUGUCGGUGAGU
1177 picture button
mml-miR-181b miR-181 Macaca mulatta
AACAUUCAUUGCUGUCGGUGGGUU
1188 picture button
mml-miR-181a miR-181 Macaca mulatta
AACAUUCAACGCUGUCGGUGAGU
1181 picture button
mml-miR-181a* miR-181* Macaca mulatta
ACCAUCGACCGUUGAUUGUACC
978 picture button
mml-miR-182 miR-182 Macaca mulatta
UUUGGCAAUGGUAGAACUCACA
964 picture button
mml-miR-183 miR-183 Macaca mulatta
UAUGGCACUGGUAGAAUUCACUG
1076 picture button
hsa-miR-184 miR-184 Homo sapiens
UGGACGGAGAACUGAUAAGGGU
923 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
760 picture button
hsa-miR-186 miR-186 Homo sapiens
CAAAGAAUUCUCCUUUUGGGCU
716 picture button
hsa-miR-187 miR-187 Homo sapiens
UCGUGUCUUGUGUUGCAGCCGG
905 picture button
mml-miR-188 miR-188 Macaca mulatta
CAUCCCUUGCAUGGUGGAGGGU
990 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
1014 picture button
mml-miR-19b miR-19 Macaca mulatta
UGUGCAAAUCCAUGCAAAACUGA
1063 picture button
mml-miR-19a miR-19 Macaca mulatta
UGUGCAAAUCUAUGCAAAACUGA
1059 picture button
mml-miR-190 miR-190 Macaca mulatta
UGAUAUGUUUGAUAUAUUAGGU
719 picture button
hsa-miR-191 miR-191 Homo sapiens
CAACGGAAUCCCAAAAGCAGCUG
869 picture button
hsa-miR-192 miR-192 Homo sapiens
CUGACCUAUGAAUUGACAGCC
913 picture button
hsa-miR-193a-5p miR-193 Homo sapiens
UGGGUCUUUGCGGGCGAGAUGA
930 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
892 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
950 picture button
mml-miR-194 miR-194 Macaca mulatta
UGUAACAGCAACUCCAUGUGGA
929 picture button
hsa-miR-195 miR-195 Homo sapiens
UAGCAGCACAGAAAUAUUGGC
953 picture button
mml-miR-196 miR-196 Macaca mulatta
UAGGUAGUUUCAUGUUGUUGG
1010 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
898 picture button
mml-miR-198 miR-198 Macaca mulatta
GGUCCAGAGGGGAAAUAGG
979 picture button
mml-miR-199a miR-199 Macaca mulatta
CCCAGUGUUCAGACUACCUGUUC
1128 picture button
mml-miR-20 miR-20 Macaca mulatta
UAAAGUGCUUAUAGUGCAGGUA
1381 picture button
mml-miR-200c miR-200 Macaca mulatta
AAUACUGCCGGGUAAUGAUGGA
1136 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
905 picture button
hsa-miR-202 miR-202 Homo sapiens
AGAGGUAUAGGGCAUGGGAA
947 picture button
hsa-miR-203 miR-203 Homo sapiens
GUGAAAUGUUUAGGACCACUAG
771 picture button
hsa-miR-204 miR-204 Homo sapiens
UUCCCUUUGUCAUCCUAUGCCU
802 picture button
hsa-miR-205 miR-205 Homo sapiens
UCCUUCAUUCCACCGGAGUCUG
941 picture button
hsa-miR-206 miR-206 Homo sapiens
UGGAAUGUAAGGAAGUGUGUGG
827 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
572 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer